Labshake search
Citations for New England Biolabs :
1451 - 1500 of 5045 citations for Human Immunodeficiency Virus GP120 Protein HIV 1 Clade C 16055 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Digestion was performed overnight by adding 50 μL of DpnII (Capture-C) or HindIII (5C) buffer and 10 μL of high-concentration DpnII or HindIII (NEB) and incubating samples at 37°C in a thermomixer ...
-
bioRxiv - Microbiology 2021Quote: ... The repair templates used for the introduction of the C-terminal tags (YFP and SNAP) were amplified by PCR (Q5 polymerase, New England Biolabs) from template plasmids ...
-
bioRxiv - Microbiology 2021Quote: ... and following the KLD enzyme step the product was heated to 65°C for 20 minutes and then double digested with PseI and FseI in CutSmart buffer (NEB) for 60 minutes at 37°C to remove any remaining plasmid that was not eliminated by the DpnI in the KLD step ...
-
bioRxiv - Microbiology 2020Quote: ... Ligation of the product and linearized vector was performed overnight at 14°C with T4 DNA ligase (New England Biolabs). The resulting construct was transformed into DH5α Escherichia coli by heat shock and transformants were obtained by selection on LB agar with carbenicillin and X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 6 h at 37°C in the absence or presence of RNase H or RNase A (40 U, NEB). Digested nucleic acids were cleaned with phenol-chloroform extraction and resuspended in nuclease-free water ...
-
bioRxiv - Microbiology 2021Quote: ... Ligation of gRNA sequence into the plasmid was made using a T4 DNA ligase at 16°C overnight and transformed into DH5α chemically competent bacteria according to the manufacturer protocol (NEB). The presence of the new gRNA into pCas9-amdSYM was confirmed by Sanger sequencing using the M13 forward primer ...
-
bioRxiv - Cell Biology 2020Quote: ... Four hundred ng of total RNA extracted from pools of 250 mouse oocytes was ligated to 400 ng of P1 anchor primer (5’-P-GGT CAC CTT GAT CTG AAG C-NH2-3’) in a 10-µl reaction using T4 RNA ligase (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Physiology 2020Quote: ... A V5 tag was appended to the C terminus of the open reading frame using Phusion site-directed mutagenesis (New England Biolabs) to generate a V5 tagged version of mouse ANGPTL4 (pHS5) ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were incubated for 45 min at 37°C and then transferred to a tube containing the ligation reaction (160 µL NEB ligation buffer 10X ...
-
bioRxiv - Microbiology 2022Quote: ... gDNA fragments were ligated with annealed adaptors overnight at 16 °C in the presence of T4 DNA ligase (NEB#M0202). Bands from 200 to 400 bp were selected by extraction from a 2% agarose gel using a Monarch DNA Gel Extraction Kit (NEB#T1020L) ...
-
bioRxiv - Molecular Biology 2019Quote: ... First strand cDNA synthesis was performed for one hour at 42 °C using M-MuLV Reverse Transcriptase (New England Biolabs). Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’ ...
-
bioRxiv - Molecular Biology 2019Quote: ... Proteins were pre-incubated at 4°C for 30 min before addition of 100 uL equilibrated amylose resin (New England BioLabs). The mixture was incubated for 1h at 4°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: A total amount of 20 µg genomic DNA was digested overnight at 37°C with 100 U EcoRV or XbaI or BamHI or HindIII (New England Biolabs) in independent reactions ...
-
bioRxiv - Genomics 2019Quote: ... LB plates at 10-fold dilutions to 1/10,000 and grown overnight at 37°C and the remainder of the cells were left in SOC (New England Biolabs) at 4°C overnight ...
-
bioRxiv - Genomics 2019Quote: ... were annealed to form adapters by incubating at 85°C for 10 min in 1x T4 DNA ligase buffer (NEB) before cooling gradually by transferring the heated block to the bench before dilution in 1x T4 DNA ligase buffer to working concentrations.
-
bioRxiv - Genetics 2019Quote: ... DNA samples were incubated at 20°C for 4h without rotation in a mix of 10 µl of 10x NEB2 buffer (New England Biolabs), 1 mM of a dNTPs mix (10 µl) ...
-
bioRxiv - Systems Biology 2020Quote: Digested DNA was heated to 50° C for 5 minutes to melt paired sticky ends then put into a 200 μL Klenow fragment (exo-, NEB) fill-in reaction containing 36 μM biotin-14-dCTP (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... eluted in 8 μl and in vitro transcribed (with the beads) at 37 °C overnight for linear amplification using the T7 High Yield RNA polymerase IVT kit (NEB). Following IVT ...
-
bioRxiv - Biochemistry 2020Quote: ... Hartmann Analytic) for 30 min at 37°C in 50 µl volumes with 20 units of T4 PNK (New England Biolabs) in the provided reaction buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... chromatin from both IP and ‘Input’ samples were eluted and de-crosslinked at 65°C for 16 hours followed by DNA isolation by PCR and DNA cleanup kit (NEB). Enrichment of AR and MED1 at specified enhancers were quantified by qPCR using specific primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR of 10 cycles with an annealing temperature 61°C was performed using Q5 High-Fidelity DNA Polymerase (#M0491S, New England Biolabs) and BEL and AL primers on 5μL of I-SceI digested DNA purified from the ChIP procedure ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... were fused to the fluorescent protein mNeonGreen with a C-terminal linker and cloned into pJBL044 under the constitutive promoter Pveg using Gibson assembly (New England Biolabs). The original pJBL044 plasmid was constructed using isothermal assembly from a fragment of pDR160 (Bose and Grossman 2011) ...
-
bioRxiv - Cancer Biology 2020Quote: ... was stored at 20° C or amplified immediately in 50 μl reactions with high-fidelity 2X PCR Master Mix (New England Biolabs) using a common forward primer and different reverse primers with unique barcodes for each sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Region B or Region C were used as templates for in vitro transcription by HiScribe T7 quick high yield RNA synthesis kit (NEB). The obtained RNA products were converted back to DNA oligo probes via reverse transcription (RT ...
-
bioRxiv - Biophysics 2021Quote: ... Two experiments were conducted in which the vacuum filling of the channels with buffer was followed by a heating/diffusion step of 1 hour at 40°C with the reservoir filled with a solution containing both DNase I (at 0.096U/μl) and BSA (NEB B9000S) at 0.13mg/ml or 0.40mg/ml ...
-
bioRxiv - Genomics 2019Quote: ... samples were digested with 10 U pshAI in 1x CutSmart buffer at 37°C for 3 or more hours (NEB).
-
bioRxiv - Biochemistry 2020Quote: ... at 95°C for 5 min and incubated with 80000 units of O-glycosidase and 100 units of neuraminidases for 4 hours at 37°C following the NEB kit protocol (E0540S; NEB). Samples were resolved on 15% Tris-tricine SDS-PAGE gel and blotted using anti-Cterm OCN goat antibody.
-
bioRxiv - Cell Biology 2020Quote: ... Protein expression was induced with 0.3 mM IPTG for 2 hours at 37°C and recombinant MBP-rabaptin5 was purified with an amylose resin (New England Biolabs) according to manufacturs instructions and dialysed against lysis buffer (20 mM Tris-HCl ph7.4 ...
-
bioRxiv - Cell Biology 2019Quote: ... 95°C for 10 minutes and equal amounts of lysates (180 ug) were treated with either 1uL of EndoH (NEB), PNGase F (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... Zyagen samples were amplified with PBC096 barcoding for 8-10 cycles with both LongAmp (female, 62°C annealing; NEB, US) and PrimeSTAR GXL (male and female ...
-
bioRxiv - Genomics 2019Quote: ... One million nuclei aliquots were pelleted by 1,000 x g at 4°C for 10 min and resuspended in 200 µl of GpC methyltransferase M.CviPI (NEB M0227L) reaction containing 1X GC Reaction Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 200 ng ΔVC1807::ErmR transforming DNA was added and reactions were incubated at 30 °C for 10 minutes before the addition of 10 units of DNAse I (NEB) to prevent additional DNA uptake ...
-
bioRxiv - Microbiology 2020Quote: ... was linearized in a 500 μL reaction volume containing 100 units of ApaLI enzyme for 4-6 hours at 37°C in CutSmart buffer (New England Biolabs). The DNA was then ethanol precipitated as previously described (76) ...
-
bioRxiv - Microbiology 2020Quote: ... The pKAS32 vector was restriction digested using SacI and XbaI at 37°C for 1 hour followed by an additional 30 minutes at 37°C with alkaline phosphatase from calf intestine (CIP) (New England Biolabs). Vector backbone and upstream and downstream segments were joined using Gibson assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: Pre-miR-181a-1 DNA template was obtained by two oligos (sequence below) after annealing and elongation at 12°C using 25U T4 DNA polymerase (NEB). The DNA template was purified with NucleoSpin PCR Clean-up kit (Macherey-Nagel) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Each PCR amplification product was digested overnight at 37 °C with 2 μl of CutSmart® uffer (New England Biolabs) and 0.2 μl of AccI enzyme (10 U/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers) and cloned by Gibson Assembly Cloning Kit (EE5510S, NEB). All primers were designed using SnapGene (GSL Biotech LLC ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Hi-C library for Illumina sequencing was prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: MBOAT7 mutants were generated by site-directed mutagenesis on the pFBM construct expressing MBOAT7 with a C-terminal GFP and strep tag using the Q5 Mutagenesis Kit (New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... a construct was cloned by PCR from the LacZ gene of Escherichia coli MG1655 with a His-tag on the C terminus by Gibson Assembly (New England Biolabs) in a pET-28b vector using the following primers LacZ200 (TAACTTTAAG AAGGAGATAT ACCATGACCA TGATTACGGA TTCACTGGCC GTCGTTTTAC ...
-
bioRxiv - Biochemistry 2022Quote: ... and C-terminal truncations (-57Q, -56IQ, -55DIQ and -54DDIQ) were performed on phyg-C-CSNAP-cerulean using the Q5 mutagenesis kit (NEB). HAP1 WT cells were transfected with 5 μg plasmid DNA using JetPRIME (Polyplus) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the RNA was fragmented at 95°C for 5 min by using a Next Magnesium RNA Fragmentation Module (New England Biolabs), and cleaned up by using a MinElute PCR Purification Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... These lysates were incubated with 2 μL Turbo DNAse I and 1 μL 1:2000 diluted RNAse I for fragmentation for 25 minutes at 37°C with constant agitation and then clarified by centrifugation (enzymes from New England Biolabs). Equivalent amounts of lysates were then precleared for 4 hours using protein A beads (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: ... The resultant adaptor-ligated Hi-C library was amplified by PCR with five to seven cycles with Q5 master mix (M0544, NEB) and index primers (E7335/E7500/E7710/E7730 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pooled total RNA was fragmented with ultrasound (4 pulses of each 30 sec at 4°C) and then treated with T4 Polynucleotide kinase (NEB). The RNA of each sample was then divided in half ...
-
bioRxiv - Molecular Biology 2023Quote: ... is inserted in n-terminal of E2 protein of CHIKV 181/25 structural genes (C-E3-E2-6K-E1) and cloned into pcDNA3.1(+) expression vector using gibson assembly cloning kit (NEB, USA). The resulting plasmid is designated as ChAC-VLP ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplified yciF (with Strep II tag on C-terminal) and pQE60 plasmid (containing an IPTG inducible T5 promoter) were digested with BamHI and EcoRI (New England Biolabs) and purified by gel extraction (MinElute gel extraction kit ...
-
bioRxiv - Neuroscience 2022Quote: ... was linearized for 18 hours at 37°C in a 250 μl reaction containing restriction enzyme NheI and CutSmart buffer (New England Biolabs). The linear DNA plasmid was next used to produce complementary RNA (cRNA ...
-
bioRxiv - Genomics 2022Quote: ... Nuclei were collected by centrifugation and in situ ligation was performed overnight at 16°C in 500 μL volumes of 1X ligase buffer (NEB) with 20,000 U T4 DNA ligase ...