Labshake search
Citations for New England Biolabs :
1351 - 1400 of 5045 citations for Human Immunodeficiency Virus GP120 Protein HIV 1 Clade C 16055 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The extracted chromatin was digested for 3 hours at 37 °C in a volume of 250.0 μL with 100 U of NlaIII (NEB) for 3C library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10-15 ng of each PCR product were digested at 37 °C for 60 min with 2.5 units of XcmI (New England Biolabs) in 15 μl reactions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the parts were assembled with Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix from NEB, 1h at 50°C) with the linkers providing sequence overlaps ...
-
bioRxiv - Microbiology 2023Quote: ... An aliquot of 10 μg DNA was digested overnight at 37°C using NlaIII and MseI restriction enzymes (NEB), purified using Sera Mag Speedbeads (Thermo Scientific) ...
-
bioRxiv - Biophysics 2022Quote: ... The C-terminal Flag tag was introduced into pcDNA3.1-Spike-WT thanks to NEBuilder® HiFi DNA Assembly (NEB). The Flag tag was added during amplification of Spike-WT from pcDNA3.1-Spike-WT with the primers ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was inactivated at 25 °C for 10 min with 1.25 μL of Murine RNAse inhibitor (New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 mM EDTA) and digested with DraIII-HF in 1x CutSmart buffer for ∼20 hr at 37 °C (NEB). Fragments with DraIII sticky ends were re-purified by 1 mL mono-Q ion-exchange ...
-
bioRxiv - Cell Biology 2023Quote: ... APOE3-C-mEm ΔSS were created from APOE3-mEm using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554S). The N-terminal domain constructs consist of residues 19-209 with or without residues 1-18 of the N-terminal signal peptide ...
-
bioRxiv - Cancer Biology 2023Quote: ... were then denatured at 95°C for 5 min and cooled at room temperature to form heteroduplexes using NEBuffer2.1 1x (NEB). The T7 endonuclease I (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 s annealing at 63 °C and 30 s elongation by Q5 High-Fidelity DNA Polymerase (New England Biolabs) at 72 °C ...
-
bioRxiv - Immunology 2023Quote: ... The libraries were generated by blunt-end cloning of 1,200 ng fragmented DNA into 1,000 ng PmeI linearized and dephosphorylated pHORF3 library vector (a gift from Michael Hust, Technische Universität Braunschweig) (16 hr at 16 °C, T4 DNA Ligase, NEB). The ligation reaction was purified and transformed into TG1 bacteria (Lucigen ...
-
bioRxiv - Genetics 2023Quote: ... Barcodes were amplified by PCR (CP21.P14: TCCTCATCCTCTCCCACATC, CP17.P12: GGACGAGGCAAGCTAAACAG, NEB Q5 for 20 cycles, Tm 67 °C). We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were digested with 0.4 μl of restriction enzyme NlaIII for 2 hours at 37°C (New England Biolabs). Digested PCR products were run on 2% agarose gels with SYBR Safe (Invitrogen ...
-
bioRxiv - Plant Biology 2024Quote: ... and SLAC1 cDNAs (N-terminal or C-terminal) were cloned in-frame into pMAL-c5X vector (New England Biolabs) using In-Fusion HD Cloning Kit (Takara Bio) ...
-
bioRxiv - Cell Biology 2024Quote: ... Ligation reactions were quenched by addition of EDTA to 25 mM and proteins were digested by incubation at 37°C for 20 min with 0.1% SDS and 20 units/ml proteinase K (NEB). Unligated oligonucleotides were removed by gel filtration through a 50 cm x 0.7 cm Sepharose 4B column (Sigma ...
-
bioRxiv - Synthetic Biology 2024Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in the Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... proximity ligation was carried out overnight at 16°C with 10000U of T4 DNA Ligase (New England Biolabs, #M0202M). Chromatin was reverse-crosslinked with 16U of Proteinase K (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... primers TZ-54 and TZ-55 were used to amplify the C-terminus of CapRelSJ46 using Taq polymerase (NEB) and 0.5 mM MnCl2 was added to the reaction as the mutagenic agent ...
-
bioRxiv - Cell Biology 2024Quote: Purified or crude viral supernatant was DNase I treated for 90 minutes at 37°C according to manufacturer’s instructions (New England BioLabs). qPCR was performed using a custom FAM probe against Nano Luciferase (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... treated or not for one hour at 56°C with 0.4 mg/mL proteinase K (P8107S, New England Biolabs) and then heated or not for one hour at 85°C.
-
bioRxiv - Genomics 2022Quote: ... 1 μl of Exonuclease 1 (NEB, M0293S) was added to each PCR product and incubated at 37C for 15 min to digest any single-stranded product ...
-
bioRxiv - Molecular Biology 2024Quote: ... in 1× NEB buffer 1 (NEB, B7001S) for 15 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% cholorophorm was added together with 10 μg mL-1 DNase 1 (NEB) and 1 μg mL-1 RNase A ...
-
bioRxiv - Molecular Biology 2024Quote: ... The four PCR products were then assembled in a 1:1:1:1 ratio using HiFi assembly (NEB, E5520S) according to the manufacturer’s instructions to create the pLenti-STARR vector (pAS5018) ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using phenol-chloroform and subjected to ribosomal RNA removal using a NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB, Ipswich, MA). A RNAseq library was prepared by using a NEBNext® Ultra directional RNA library prep kit (NEB ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 µg of RNA for each sample was treated with DNase I at 37°C for 10 minutes (New England Biolabs) and 0.5 µg was used for reverse transcription with the GoScript Reverse Transcription Mix ...
-
bioRxiv - Biophysics 2021Quote: ... The AcrIIA4 expression vector was modified to express AcrIIA11 with a C-terminal NLS and HA tags using the HiFi Assembly Kit (NEB).
-
bioRxiv - Biochemistry 2021Quote: ... RNA integrity was assessed by performing 1% TBE agarose gel electrophoresis with samples that had been boiled for 95°C for 5 min in RNA loading dye (New England Biolabs). Genomic DNA was eliminated by incubating 2 μg of RNA with 2 U of RQ1 RNase-free DNase I (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... with primers to introduce BamHI and NotI sites and cloned into pcDNA4/TO-3xFLAG (C-terminal tag) using T4 DNA ligase (New England Biolabs). pcDNA4/TO-ORF24 202-752-3xFLAG (Addgene #138424 ...
-
bioRxiv - Microbiology 2021Quote: ... Cell debris was removed by centrifugation at 15,000 x g for 30 min at 4°C and the clarified extract was loaded onto a chitin resin (NEB) column pre-equilibrated with column buffer for purification at RT ...
-
bioRxiv - Genetics 2021Quote: ... which was followed by 37°C for 30 min with addition of 50ul 10% Triton-X 100 to quench SDS and 37°C overnight with addition of 40ul AluI (R0137L, NEB) total ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were individually treated for 16 h at 37 °C with 20 units of DpnI enzyme (New England Biolabs). Following gel extraction using Wizard SV Gel and PCR CleanUp System (Promega) ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were then incubated overnight at 37 °C in Hybridization Buffer (10% Formamide, 10% 20x SSC, 400 µg/ml E. coli tRNA (New England Biolabs), 5% dextran sulfate ...
-
bioRxiv - Developmental Biology 2020Quote: ... TA overhangs were added by incubating the insert for 10 min at 72 °C with 50mM DNTPs and Taq polymerase (NEB), in order to perform TA cloning into a PCR4 TOPO vector (ThermoFisher) ...
-
bioRxiv - Genomics 2020Quote: ... A 20 μL aliquot of DNA was repaired (15 min, 25 °C) in a 40 μL reaction using T4 DNA polymerase (New England Biolabs). After purifying the DNA (MinElute™ Reaction Cleanup Kit ...
-
bioRxiv - Biochemistry 2022Quote: ... trcP or fragments of the trcP ORF were cloned into pHL100’s SmaI site with the 23 nt upstream sequence and the Flag tag sequence on the C-terminal using NEBuilder HiFi DNA Assembly Master Mix (NEB); subsequently ...
-
bioRxiv - Cell Biology 2022Quote: ... human emerin was first fused to the C-terminus of a SNAP tag by AscI and XhoI insertion in a pSNAP-tag(m) plasmid (NEB). SNAP-emerin was then subcloned into a modified pFUW lentiviral vector by NheI and AgeI insertion ...
-
bioRxiv - Biochemistry 2022Quote: ... a cysteine was added to the N-terminus of the coding sequence directly after the precision protease recognition site or after the six-histidine tag on the C-terminus using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: Micro-C sequencing libraries were generated by using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645) with some minor modifications ...
-
bioRxiv - Genomics 2020Quote: ... Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB: #R0543) with agitation at 900 RPM ...
-
bioRxiv - Molecular Biology 2020Quote: ... were separately subjected to restriction enzyme double digestion at 37 °C overnight in 20 μL volumes containing 20 U BamHI-HF (cat. no. R3136S, New England BioLabs), 20 U EcoRI-HF (cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were treated with Klenow exo- at 37 °C for 30 min to fill the ends of adaptors and then trimmed with T4 DNA polymerase (NEB) at 12 °C for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... after incubating the samples with 2 μl of RNase A (Thermo) at 37 °C for 2h and then with 8 μl of proteinase K (NEB) at 55 °C for 4h ...
-
bioRxiv - Molecular Biology 2021Quote: ... left to air-dry and then digested overnight at 37°C in 50 μl TE with 20 U EcoRI-HF (NEB). Samples were extracted with 50 μl phenol:chloroform ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by the insertion of a DNA fragment containing C-terminal 2×HA tag by NEBuilder HiFi DNA Assembly Master Mix (NEB). Finally ...
-
bioRxiv - Genomics 2019Quote: ... 400 ng of purified DNA was ligated overnight at 16 °C to adapters (Table S4) with T4 DNA ligase (NEB). Ligated DNA was purified using MiniElute columns (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... and msDNA extracts were incubated overnight at 37°C with 0.5 units/μL of truncated RecE (NEB; catalogue number M0545S). Subsequently ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Molecular Biology 2019Quote: ... The reactions were incubated for 60 minutes at 37 °C and terminated by the addition 2 μL of Proteinase K (NEB) which had been supplemented with 0.1 reaction volume of 1 M Tris-HCl pH 8.0 ...
-
bioRxiv - Genomics 2020Quote: ... at 37°C overnight and purified digests were ligated overnight at 16°C using T7 DNA ligase as per manufacturer’s instructions (NEB M0318). Ligation reactions were transformed into One Shot™ Stbl3™ chemically-competent E.coli cells (42°C heat-shock ...