Labshake search
Citations for New England Biolabs :
1651 - 1700 of 5045 citations for Human Immunodeficiency Virus GP120 Protein HIV 1 Clade C 16055 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: 300-500 ng purified mRNA was fragmented for 15 min at 70°C to ~100 nt using the NEBNext fragmentation module (NEB # E6150S) and purified using the Qiagen MinElute kit (Qiagen # 74204 ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was then end-repaired for 30 minutes at 25°C using 250 ng sample in a 25 µl reaction with 1.5 units T4 Polymerase (NEB cat. # M0203), 5 units T4 polynucleotide kinase (NEB cat ...
-
bioRxiv - Bioengineering 2020Quote: ... and cloned into pET vector in frame with a C-terminal 6XHis tag by Gibson assembly (NEBuilder® HiFi DNA Assembly Master Mix, New England Biolabs). DNA encoding SARS-CoV-2 S RBD (S a.a ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.5-1.0 μg of genomic DNA for each sample was heated at 65°C for 2-3 hours prior to digestion with PstI (New England Biolabs, UK). This enzyme has a 6 bp recognition site and leaves a 4 bp overhang ...
-
bioRxiv - Microbiology 2020Quote: ... and incubated at 37°C for 18 hours and the plasmid was extracted using the Monarch Plasmid Miniprep Kit (New England Biolabs, US) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... eukaryotic recombinant Stlac2 was denatured with Glycoprotein denaturing buffer at 100 °C for 10 min to be deglycosylated using PNGase F (NEB, USA) according to instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The Gag-PYQE-mCherry plasmid was modified by site-directed mutagenesis to make a base pair substitution mutation (C to A) that changes the PYQE motif to PYKE using the Q5 SDM kit (New England Biolabs, USA). Gag-PYQE-mCherry plasmid was linearized by PCR using 5’-AAGGAGCCTCTGACGAGCC-3’ as forward primer (with the C to A base pair substitution underlined ...
-
bioRxiv - Genomics 2021Quote: The AID C-terminal RPB1-AID-eGFP-blasticidin vector was assembled by Gibson Assembly (NEBuilder HiFi DNA Assembly Master Mix, NEB, E2621L) in the pENTR221 kanamycin vector using the following templates ...
-
bioRxiv - Genomics 2021Quote: ... and introduced between XhoI and BamHI sites in c-Flag pcDNA3 (addgene #20011) to generate Flag-tagged hPEX5 using NEBuilder® HiFi DNA assembly Master mix (New England Biolabs). Site-directed mutagenesis for amino acid substitution was performed using the Q5® Site-directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The Nested PCR product (5 μl) was digested with NciI restriction enzyme at 37°C for 15 min (New England Biolabs, USA). The final digested DNA fragments was resolved in 2.5 % gel electrophoresis stained with ethidium bromide and visualized with Bio-Rad gel doc XR (Molecular Imager ...
-
bioRxiv - Microbiology 2021Quote: The predicted late domain motifs encoded in TgGRA14 C-terminus were mutated in the pGagGRA14_Venus by site-directed mutagenesis (Q5 Site-Directed mutagenesis kit NEB, Cat#E0554S). Primers encoding mutation alanine substitutions for PTAP or YPXL were used to generate pGagGRA14TSG101-_Venus and pGagGRA14ALIX-_Venus (P11 + P12 and P13 + P14) ...
-
bioRxiv - Genomics 2022Quote: ... chromatin was digested overnight at 37°C with the addition of 25 μL 10X NEBuffer2 and 100U (5 μL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62°C to inactivate the HindIII ...
-
bioRxiv - Biochemistry 2022Quote: ... Deglycosylation was performed using Peptide-N-Glycosidase F (PNGase F) at 37 °C for one hour according to the supplier’s protocol (New England Biolabs, Hitchin, UK). Enzyme purity and molecular weight were estimated by 12 % SDS-PAGE using mini-PROTEAN 3 system (BioRad ...
-
bioRxiv - Biochemistry 2022Quote: ... the sample was diluted to 50 μL with ammonium bicarbonate buffer and incubated at 37 °C with 2 μL of PNGase F (New England Biolabs P0705S) diluted 1:100 in ammonium bicarbonate for an additional 7 hours ...
-
bioRxiv - Microbiology 2022Quote: ... Around 100ng of the RNA was kept as input control and stored at -80°C whereas the remaining amount was subjected to immunoprecipitation using m6A specific antibody (NEB #E1610S). Initially ...
-
bioRxiv - Molecular Biology 2022Quote: ... with a terminal elongation step for 4 min at 72°C employing a proofreading Taq polymerase (Q5 High-Fidelity DNA polymerase, New England Biolabs, Germany). After verification of the amplicon sequence ...
-
bioRxiv - Neuroscience 2023Quote: ... at −80 °C prior to RNA extraction and library preparation with NEB Next® Ultra™ RNA Library Prep Kit (NEB) by Novogene ...
-
bioRxiv - Microbiology 2023Quote: ... The sonicated DNA was end-repaired for 30 minutes at 20°C in 200 μl final volume containing 1x end-repair buffer and 10 μl of end-repair mix (NEB, E6050L). The reaction was cleaned in 2x AmpureXP Beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2024Quote: ... The biotin handle and cosmid-I95 DNA were both digested for 2 h at 37 °C with SpeI-HF (New England Biolabs, R3133L) and subsequently heat-inactivated for 20 min at 80 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplification of 4 µl circularized cDNA was performed in a reaction volume of 48 μl in the presence of 500 nM PCR forward primer (AATGATACGGCGACCACCGAGATCTACA*C, where * is a phosphorothioate bond) and indexed NEBNext® Multiplex Oligoes for Illumina (NEB), 0.48 U KAPA HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The tube containing the plugs was then cooled to 42°C before adding 5 µl of Beta-Agarase I (New England Biolabs, M0392) and incubating at 42°C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... C terminal and αPKC binding region) or PICK1 (BAR domain) were made with NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520S). Mutations of PICK1 (KD-AA and 5K-E ...
-
bioRxiv - Developmental Biology 2024Quote: ... The rbpms2bsa9329 surrounding genomic region was amplified for 35 cycles with an annealing temperature of 60°C and the mutant allele was digested with MboII (New England Biolabs, R0148S)2 or the wild-type allele was digested with HphI (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Positive colonies were incubated overnight at 37°C and plasmids were isolated using the Monarch Plasmid Miniprep Kit (New England Biolabs, T1010L). For all assembled plasmids the sequence was confirmed by Sanger sequencing ...
-
A synthetic elastic protein as molecular prosthetic candidate to strengthen vascular wall elasticitybioRxiv - Cell Biology 2023Quote: ... pET30a-SEP vector was stored at -20°C prior to transform BL21 (DE3) competent bacteria (New England Biolabs, Évry-Courcouronnes, France).
-
bioRxiv - Cell Biology 2023Quote: ... Restriction enzyme was inactivated using 1.6% of SDS for 25 minutes at 65°C and chromatin was ligated by adding 4000 U of T4 ligase (New England Biolabs, M0202M) in 1× T4 DNA ligase buffer (New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: ... Deglycosylation was performed using Peptide-N-Glycosidase F (PNGase F) at 37 °C for one hour according to the supplier’s protocol (New England Biolabs, Hitchin, UK). Enzyme purity and molecular weight were estimated using a 12% SDS-PAGE and mini-PROTEAN 3 system (BioRad ...
-
bioRxiv - Genomics 2023Quote: ... and incubated for 20 min at 37°C in the presence of 1,000 gel units of micrococcal nuclease (catalog number. M0247S; NEB, Ipswich, MA) in a 500 ul volume of buffer ...
-
bioRxiv - Genetics 2023Quote: RNA was isolated from frozen hippocampal samples stored at -80°C using the Monarch® RNA Total Isolation kit (NEB T2010S). Hippocampus from the left hemisphere was used where possible ...
-
bioRxiv - Biophysics 2023Quote: ... These plasmids were digested with NotI-HF and XhoI for 2 h at 37°C (R3189, R0146, New England Biolabs, UK) and heat-inactivated for 20 min at 80°C.
-
bioRxiv - Neuroscience 2023Quote: ... The mRNA was fragmented using divalent cations under 94°C for 5-7min using the NEBNextTM Magnesium RNA Fragmentation Module (New England Biolabs, #E6150S). RNA fragments were reverse-transcribed using SuperScriptTM II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... The fragmented RNA was then subjected to a 5’ dephosphorylation reaction at 37°C for 30min by adding rSAP (NEB, M0371L) and PNK enzyme (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... biosensors with immobilized DNA were incubated overnight at 37°C with 80 U NdeI in 300 µL rCutSmart buffer (NEB, Germany). In parallel ...
-
bioRxiv - Genetics 2023Quote: ... After 48 h cells were incubated for 30 min at 37 °C with SNAP-Oregon green (NEB, final concentration 4 µM). Cells were then incubated for 30 min at 37 °C in fresh media to wash off unbound substrate ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were first denatured with Glycoprotein Denaturing Buffer at 65°C for 15 min and then treated with Endoglycosidase H (Endo H) (New England Biolabs, #P0702S) or Peptide-N-Glycosidase F (PNGase F ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 μg of digested nucleic acids were treated overnight at 37 °C with or without 10 μl of RNase H (New England BioLabs, M029L) in 1x RNase H buffer and 1/10th of the samples was saved as input ...
-
bioRxiv - Genetics 2023Quote: ... Samples were then incubated in 30°C water bath for 5 hours with 50 μL of RCA mixture that contained 250 μM dNTP (New England Biolabs, N0447L), 1 mM extra-supplemented DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ... All mRNAs were transcribed at 30°C for 2 hrs using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040S) and were co-transcriptionally capped (8:1 cap analog to GTP for ∼90% capping efficiency ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to linearize plasmid (10 µg) by incubating at 37 °C for a minimum of 2 hours in 1x CutSmart buffer (NEB, B7204S). Linearized plasmid was purified by extraction with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1 ...
-
bioRxiv - Genetics 2023Quote: ... 300ng of genomic DNA from leaves of M82 and MT pX11 lines were incubated at 37°C overnight with PstI-HF or HindIII-HF (New England BioLabs®) restriction enzymes respectively ...
-
bioRxiv - Developmental Biology 2023Quote: ... This plasmid was modified to include a C-terminal V5 tag using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). For arnt1-myc ...
-
bioRxiv - Bioengineering 2023Quote: ... then the mixture was cooled to room temperature (∼22 °C) prior to immediate transformation into NEB Stable chemically competent bacteria (NEB #C3040H).
-
bioRxiv - Microbiology 2023Quote: ... Two μl of a 1:250 dilution of the annealed oligos were ligated to 50 ng of dephosphorylated BsaI-digested vector at 16°C overnight in 20 μl final volume containing 1x T4 DNA ligation buffer (NEB, B0202S), and 400U T4 DNA ligase (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equivalent amounts of gDNA from the different cells lines was digested in a 37°C water bath for four hours with HpaII and MspI isochizomer enzymes (NEB, Inc.) Following digestion ...
-
bioRxiv - Microbiology 2023Quote: ... A 3x HA-tag was fused to the C-terminal region of the amplified product along with the 3’UTR formed through Gibson assembly master mix (NEB, E2611S). To generate the PfMORC-HA knockdown constructs ...
-
Nucleolar Pol II interactome reveals TBPL1, PAF1, and Pol I at intergenic rDNA drive rRNA biogenesisbioRxiv - Molecular Biology 2023Quote: ... The isolated DNA was then resuspended in TE buffer and incubated overnight at 37°C with HindIII (New England Biolabs (NEB), Cat# R01045) ...
-
bioRxiv - Molecular Biology 2023Quote: ... paired oligonucleotides were incubated at 37°C for 30 min in a reaction mixture supplemented with T4 PNK (NEB, Massachusetts, USA) and T4 Ligation Buffer (NEB ...
-
bioRxiv - Genomics 2023Quote: MChIP-C NGS libraries were prepared from immunoprecipitated DNA with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645) according to the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2024Quote: ... 250 ng of RNA samples were digested at 37°C for 2 hours with Nucleoside Digestion Mix (New England Biolabs, M069S). Digested RNA samples were diluted to 100 µl with double-distilled water and filtered through 0.22 µm Millex Syringe Filters ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... ddRAD library preparation included an initial digestion of 300 ng of DNA in a 34 μL reaction (2 hours at 37 °C; 10 U each of SbfI and MspI, New England Biolabs Inc.). Standard Illumina adapters were ligated using 60 cycles of digestion at 37 °C (2 minutes ...