Labshake search
Citations for New England Biolabs :
1351 - 1400 of 2067 citations for 5 Sulfosalicylaldehyde sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... A single adenine base was added to fragment ends by Klenow fragment (3′ to 5′ exo minus; NEB), followed by ligation of Illumina adaptors (Quick ligase ...
-
bioRxiv - Cell Biology 2024Quote: ... washed and incubated with T cell medium containing 5 μM (Snap-Cell Block S9106S, New England Biolabs, NEB) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... washed and incubated with T cell medium containing 5 μM (Snap-Cell Block S9106S, New England Biolabs, NEB) for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the samples were washed three times for 5’ each with PBS-0.01%Tween and incubated with 0.24 mg/ml Monarch RNase A (New England Biolabs) for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... The fragments were re-phosphorylated at their 5’-hydroxyl groups using T4 polynucleotide kinase (New England Biolabs; M0201S) and purified using the miRNeasy Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM MgCl2) and either 25 nM NudE.1 WT or NudE.1 E64,65Q or NudC WT (NEB). For NAD spike-in kinetics ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μl of 10 mM MnCl2 and 1 μl (400 units) of λPP (New England Biolabs, Ipswich, MA). Untreated lysates received 1 μl of H2O in place of λPP ...
-
bioRxiv - Molecular Biology 2023Quote: 9N_VRA3 adapter oligonucleotide (Supplementary Table 1) was pre-adenylated with the 5’ DNA Adenylation Kit (New England Biolabs) according to the manufacturer’s protocol at a 5X scale ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.2% Tween-20) and RNA 5’ ends where labelled with [γ-32P]-ATP and T4 PNK (NEB, M0201L) at 37°C for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA adaptor provided by the kit was phosphorylated on its 5’ end using T4 Polynucleotide Kinase (NEB). RNA (1 μg ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA probes (Extended Table 1) at 500 nM were 5’-[32P]-labeled using T4 Polynucleotide Kinase (NEB) and hybridized to the membrane overnight at 37°C in PerfectHyb™ Plus Hybridization Buffer (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA templates were then degraded by incubating reactions with 5 units of RNase H (M0297, New England Biolabs) and 1 μl RNase cocktail enzyme mix (AM2296 ...
-
bioRxiv - Biochemistry 2023Quote: Pre-crRNA was 5’-radiolabeled with [γ−32P] ATP (Perkin-Elmer) using T4 polynucleotide kinase (New England Biolabs). For some measurements ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ligation, samples were washed in CutSmart buffer, preincubated (5 min, RT) in 1x T4 ligase buffer (NEB), and incubated (18 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK, NEB). Next ...
-
bioRxiv - Cell Biology 2023Quote: ... A stock solution of these oligos (1μl of a 10μM) was 5’-end-labeled using T4PNK (NEB®) and 5μl of ATP ...
-
bioRxiv - Genomics 2023Quote: ... DNA was then pre-amplified 5 cycles with NEBNext Ultra II Q5 master mix (New England Biolabs, M0544) with a cycling protocol of 72°C for 5 min ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 µl of 100 mM dATP solution and 2.5 µl of Klenow Fragment (3′->5′ exo-) (NEB, #M0212L) were added to the mixture ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.5 μL BsaI-HF® v2 NEBridge® Golden Gate Assembly mix (E1601, NEB, 5 μL final volume), and 0.5 μL T4 DNA ligase buffer was aliquoted across a PCR plate ...
-
bioRxiv - Biochemistry 2023Quote: ... dynein-bound beads were mixed with 5 µM SNAP-Cell-TMR or SNAP-AlexaFluor-647 (New England Biolabs) for 10 min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 µl 100× Protease inhibitor cocktail and 1 µl of CviKI-1 (5 U/100,000 nuclei, NEB R0710S) were added ...
-
bioRxiv - Cell Biology 2023Quote: ... For an R-loop negative control the preparation was treated with 5 U RNaseH (M0297S, NEB Japan, Japan) in 1× RNaseH Reaction Buffer (NEB Japan ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligonucleotides corresponding to the ‘right’ half were 5′-phosphorylated using T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA). Equimolar amounts of ‘right’ strand ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by on-bead 5’ ligation of a biotinylated REL5 linker sequence using T4 RNA ligase 1 (NEB) for 3 h at 37⁰C ...
-
bioRxiv - Molecular Biology 2023Quote: ... three 25 μl PCR reactions were pooled and purified using Monarch PCR & DNA Cleanup Kit (5 μg; NEB), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli strain MET961 was constructed by replacing the glgB gene of strain NEB 5-alpha (New England Biolabs) with the glgB::Kan-pWV01repA region from E ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of the polyC-tailed products were used with 1X Taq Mg-free Buffer (New England Biolabs), 500 nM of each primer (Table 2) ...
-
bioRxiv - Genetics 2024Quote: ... Around 300 ng of sRNA from each sample was first treated with RNA 5′ pyrophosphohydrolase (New England Biolabs) at 37 °C for 30 min ...
-
bioRxiv - Genetics 2024Quote: ... An additional 20-minute digestion was then performed with 5 µL RNase A (NEB #T3018, 20 mg/ml). The rest of the protocol remained unchanged ...
-
bioRxiv - Genomics 2024Quote: ... 2 μL of 10% Tween-20 and 5 μL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Cell Biology 2024Quote: ... dynein-bound beads were mixed with 5 μM SNAP-Cell-TMR or SNAP-AlexaFluor-647 (New England Biolabs) for 10 minutes at room temperature.
-
bioRxiv - Microbiology 2024Quote: In vitro transcribed CHIKV RNA (nt’s 1-337) was 5’ dephosphorylated using Quick CIP according to the manufacturer’s instructions (NEB) before purification using an RNA Clean & Concentrator column (Zymo Research) ...
-
bioRxiv - Molecular Biology 2024Quote: ... using ETAA1 DBR R1 RT-PCR primer 5′-AAGTTCTTCTTCTTGACTTTGTGTT-3′ and treated with RNaseH (New England Biolabs, M0297S). 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega ...
-
bioRxiv - Biochemistry 2024Quote: ... and then 5’ phosphates of the nucleotide sample were removed with 0.5 units of quick-CIP (NEB, #M0525) at 37 ºC for 2 hr with agitation at 800 rpm for 1 min every 10 min.
-
bioRxiv - Microbiology 2024Quote: ... followed by a 5-min extension cycle using Q5® High-Fidelity 2X Master Mix (New England Biolabs). PCR products were then purified using QIAquick® Gel Extraction Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5% glycerol) and one time with molecular grade water followed by incubation with proteinase K (New England Biolabs) at 55 °C for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5% glycerol) and one time with molecular grade water followed by incubation with proteinase K (New England Biolabs) at 55 °C for 30 minutes with constant shaking ...
-
bioRxiv - Molecular Biology 2024Quote: ... The labeling of oligonucleotides at the 5’-end was carried out by T4 polynucleotide kinase (New England Biolabs) and [γ-32P] ATP (Hartmann Analytic) ...
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Genetics 2021Quote: ... Tagmented library was amplified with P5_BRB and BRB_Idx7N5 primers (5 μL, Supplementary Table 14) using NEBNext UltraTM II Q5 Master Mix (NEB, M0544L) which was incubated at 98 °C for 30 sec before adding DNA with the following conditions ...
-
bioRxiv - Genetics 2021Quote: ... and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S, NEB), 6μl biotinylated bridge linker (200ng/ul) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... at 50°C for 60 min with a subsequent Klenow DNA polymerase step using 5 units (New England Biolabs) at 37°C for 60 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Molecular Biology 2021Quote: The RNA primer was labelled at the 5’ terminus with [γ-32P]ATP using T4 PNK (New England Biolabs) and PAGE purified ...
-
bioRxiv - Molecular Biology 2021Quote: ... eight rounds of linear amplification PCR reactions with 40μg genomic DNA were performed with 5 μg genomic DNA each using HS Flex polymerase (NEB) and biotinylated Myc primer (Table S2) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...