Labshake search
Citations for New England Biolabs :
1301 - 1350 of 6947 citations for hsa mir 940 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA samples were PCR-amplified using standard Illumina adaptors and Q5 PCR mix (NEB) with 10-13 cycles (SMInputs ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were generated by two-step PCR utilizing Q5 polymerase (New England Biolabs) with an annealing temperature of 72°C and a 2-minute extension time ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were performed utilizing the Phusion High-Fidelity PCR Master Mix (NEB, M0531L) to prevent any mutations ...
-
bioRxiv - Genomics 2023Quote: ... DNA was amplified by PCR with NEBNext HiFi 2x PCR Master Mix (NEB M0541S) and library was purified by 1.3X SPRI purification (Omega Bio-Tek ...
-
bioRxiv - Genetics 2023Quote: ... PCR reactions were performed with Phusion High-Fidelity PCR Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... The VHH specific sequence was amplified using PCR (Phusion High Fidelity PCR kit, NEB) and correct overhangs were incorporated ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was performed using Phusion High-Fidelity PCR Master Mix (New English Biolabs, England). PCR products were quantified using 2% agarose gel electrophoresis ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PCR reactions contained 1X Phusion High-Fidelity PCR Master Mix (New England BioLabs Inc.), 0.5 μM primers (forward ...
-
bioRxiv - Microbiology 2023Quote: ... the PCR reaction was purified using the Monarch PCR Cleanup Kit (New England Biolabs). DNA was sent for Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: PCR products were routinely purified using Monarch® PCR & DNA clean-up kit (NEB), or E.Z.N.A.® Cycle Pure Kit (Omega Bio-Tek ...
-
bioRxiv - Genomics 2023Quote: ... PCR was performed with the Phusion High-Fidelity PCR kit (E0553L, New England BioLabs) with the following cycling conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was performed using NEBNext® High-Fidelity 2X PCR Master Mix (NEB; M0541S). The purified PCR products were separated by a 4-20% TBE gel (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... and PCR amplified and barcoded with NEBNext High-Fidelity PCR Mix (New England Biolabs) and unique dual indexes (Illumina) ...
-
bioRxiv - Systems Biology 2024Quote: ... PCR products were spin-purified using the Monarch PCR & DNA Cleanup Kit (NEB T1030) or the DNA Clean & Concentrator-5 kit (Zymo Research ...
-
bioRxiv - Immunology 2024Quote: ... and PCR amplified with NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs). Following purification with the PCR Purification Kit (QIAGEN) ...
-
bioRxiv - Cancer Biology 2024Quote: ... For PCRs we used Phusion High-Fiedlity PCR Master Mix with HF Buffer (NEB) and reactions were run as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Linearized cDNA was PCR amplified using Phusion High-Fidelity PCR Master Mix (NEB, M0531S).
-
bioRxiv - Genetics 2021Quote: ... 0.5 μM MPRA_v3_F and MPRA_v3_20I_R primers (Supplementary Table 14) and 2 ng BSA (NEB, B9000). PCR master mix was emulsified by vortexing with 220 μL Tegosoft DEC (Evonik) ...
-
bioRxiv - Cell Biology 2022Quote: ... NEBNext Multiplex Oligos for Illumina Index Primers were used for library preparation (New England Biolabs). Libraries were sequenced using an Illumina HiSeq4000 to obtain single-end 36 nt sequences at the University of Chicago Genomic Facility.
-
bioRxiv - Biochemistry 2019Quote: ... The cDNA was amplified for 6-16 cycles (primers below) with Phusion Polymerase (NEB, #E0553L) and gel-purified with ZymoClean Gel DNA Recovery Kit (Genesee Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and random primers and cDNA obtained amplified using Q5® DNA Polymerase (New England Biolabs) with gene specific oligonucleotide primers (Table 1).
-
bioRxiv - Microbiology 2021Quote: ... following manufacturer’s instructions and NEB Next Multiplex Oligos for Illumina (96 Index Primers, NEB #E6609) for multiplexing ...
-
bioRxiv - Microbiology 2020Quote: ... Specific primers were designed following the instructions of the Q5 site-directed mutagenesis kit (NEB) (primers 35-38 ...
-
bioRxiv - Biochemistry 2021Quote: ... primers were designed using CRY-WT-CLIP as the template by NEBaseChanger (New England Biolabs). The desired DNA was amplified by PCR as above ...
-
bioRxiv - Genetics 2022Quote: ... The reverse primers for this reaction were the NEBNext® Multiplex Oligos for Illumina (NEB; Supplementary information ...
-
bioRxiv - Biochemistry 2022Quote: ... 29 μl of purified modified RNA was added to 100 ng Random Primer 9 (NEB) and 0.2 mM of each dNTP ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was amplified with primers flanking each splice site by Taq polymerase (NEB, Hitchin, UK) (thermocycling parameters outlined in Table 3) ...
-
bioRxiv - Microbiology 2021Quote: ... primers MR161 and MR162 (Table 2) were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs) at 37°C for 1 h in a 4.5 μl reaction volume with 10 μM primer ...
-
bioRxiv - Genomics 2019Quote: ... followed by the addition of 0.5 µl of 250 mM Random Primer 6 (S1230S, NEB) and 1 µl Deoxynucleotide Solution Mix (N0447 ...
-
bioRxiv - Microbiology 2019Quote: ... The primers were designed using the NEBuilder for Gibson Assembly tool online (New England Biolabs) and were constructed to be used with the pNPTS138 vector (MRK Alley ...
-
bioRxiv - Genomics 2020Quote: ... the linker for reverse primers: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG using Q5 Hot Start High Fidelity DNA polymerase (NEB) and sequenced by using a NextSeq500 Instrument (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... All primers for Gibson assembly were designed using NEBuilder Assembly Tool (New England Biolabs, Inc.). For the bacA complementation vector ...
-
bioRxiv - Genomics 2019Quote: ... using an oligo(dT)24 primer and then treated with RNase H (New England Biolabs). For each time point ...
-
bioRxiv - Cancer Biology 2022Quote: ... we PCR amplified a mCMV from a plasmid using primers XhoI_attL1_mCMV_FW and SalI_mCMV_RV followed by T7 ligation (NEB) of both PCR products ...
-
bioRxiv - Plant Biology 2022Quote: ... All primers were designed with appropriate overlapping overhangs and HiFi DNA assembly master mix (NEB) was used for cloning ...
-
bioRxiv - Plant Biology 2022Quote: ... Primers for this protocol were designed using the online tool supplied by NEB (http://nebasechanger.neb.com). The second set was obtained using a high-fidelity polymerase and the following protocol (Wang and Malcolm 1999) ...
-
bioRxiv - Biophysics 2023Quote: ... Derivatives of pSB963 were altered using mutagenic primers and Q5 site-directed mutagenesis kit (NEB) to generate vectors containing CEN9 ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA (2 µg) was first annealed with 200 ng random nonamer primers (NEB S1254S) by incubation at 70°C for 5 min ...
-
bioRxiv - Genetics 2023Quote: ... NEBNext Multiplex Oligos for Illumina Index Primers were used for library preparation (New England Biolabs). Libraries were sequenced using an Illumina HiSeq4000 to obtain single-end 50 nt sequences at the University of Chicago Genomic Facility ...
-
bioRxiv - Genetics 2023Quote: ... NEBNext Multiplex Oligos for Illumina Index Primers were used for library preparation (New England Biolabs). Libraries were sequenced using an Illumina NovaSeq6000 to obtain single-end 100 nt sequences at the University of Chicago Genomic Facility.
-
bioRxiv - Biophysics 2023Quote: ... each primer pair was annealed and consequently phosphorylated with T4-polynucleotide kinase (T4-PNK; NEB). Restriction digestion of the pLentiCRISPRv2 vector was performed using FD-Esp3I (Thermo ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pEM791 vector (32) were amplified with primers designed for Gibson Assembly (New England BioLabs). After confirming the correct sequence of the Gibson assembled plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... Dual-index primers were conjugated with NEBNext Multiplex Oligos for Illumina (Set1, New England Biolabs). We pooled all libraries ...
-
bioRxiv - Genetics 2021Quote: ... 1 μg of total Trizol-purified RNA purified was used for library preparation using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (NEB) with libraries indexed in 12 cycles PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... Purified small RNA was subject to library prep using NEBNext Multiplex Small RNA Sample Prep Set for Illumina (NEB E7330) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... ChIP DNA was subject to library prep using NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (NEB E6240) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA was cleaved from the beads with DpnII and libraries were prepared for sequencing using the NEBNext DNA Library Prep Master Mix Set for Illumina (New England BioLabs).
-
bioRxiv - Genomics 2020Quote: ... Libraries were prepared from 1000 ng total RNA using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs) by the Transcriptional Regulation and Expression Facility at Cornell University.