Labshake search
Citations for New England Biolabs :
1201 - 1250 of 1251 citations for Recombinant Mouse Angiotensinogen serpin peptidase inhibitor clade A member 8 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: Mouse Hapln1 (NM_013500) was cloned into the pAAV vector by PCR with the following primers and ligase (NEB) or In-Fusion cloning (Takara) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... in conjunction with the NEBNext® rRNA Depletion Kit for Human/Mouse/Rat (New England BioLabs, Ipswich, MA, USA) and the MICROBExpress kit (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... elegans and mouse cDNA (PolyATtract® mRNA Isolation Systems, Promega and ProtoScript® First Strand cDNA Synthesis Kit, NEB). Detailed sub-cloning information is available upon request.
-
bioRxiv - Cell Biology 2022Quote: mRNA was enriched from 100ng DNase treated total RNA using the NEBNext rRNA depletion Kit (human, mouse, rat, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... A 140-500 ng aliquot of total RNA was rRNA depleted using NEB’s Human/Mouse/Rat RNAse-H based Depletion kit (New England BioLabs). Following rRNA removal ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Microbiology 2024Quote: ... AnTat1.1 sequence was obtained from AnTat1.1 specific cDNA from mouse infection D6 cloned into a pMiniT vector with the PCR Cloning Kit (NEB, E1202S). VSG-228 was partially amplified from VSG PCR (see below ...
-
bioRxiv - Neuroscience 2023Quote: ... To generate these constructs gene block fragments that codify for those sequences were produced in the Duke Transgenic Mouse Facility and cloned into the backbone using EcoRI-HF Restriction Enzyme (NEB) and In-Fusion HD Cloning Kit (Takara ...
-
bioRxiv - Immunology 2023Quote: ... The custom sgRNA vector used in this study was a hybrid AAV-SB-CRISPR plasmid for targeting primary mouse NK cells (AAV-SB100x) that was constructed by gBlock fragments (IDT) followed by Gibson Assembly (NEB). The Surf-v2 library was cloned into the AAV-SB-CRISPR vector by pooled cloning to generate the AAV-SB-Surf-v2 plasmid library.
-
bioRxiv - Molecular Biology 2023Quote: ... The corresponding regions of a partial mouse Azin1 gene were amplified from mouse tail genomic DNA by using Phusion Hot Start Flex 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... rRNA depletion was performed using a NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and RNA was purified using Agencourt RNAClean XP Beads (New England Biolabs). Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Immunology 2021Quote: Point or deletion mutations were prepared from human or mouse CRT expression clones in pCMV3-C-Myc (SinoBiological) using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s protocol and primers designed using the NEBaseChanger™ web tool ...
-
bioRxiv - Systems Biology 2020Quote: ... rRNA depletion and library preparation for sequencing was completed with the NEBNext protocol (‘Protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Neuroscience 2021Quote: The moPrP-eGFP_39/40 fusion construct carrying eGFP within the flexible N-terminal tail between aa 39 and 40 of mouse PrP was created using NEB® Golden Gate Assembly (New England Biolabs). In brief ...
-
bioRxiv - Cancer Biology 2020Quote: ... we performed eight 100 μl PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) using Q5 High-Fidelity 2x Master Mix (New England Biolabs, M0494X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2022Quote: ... DNA fragments ranging from 3 kb to 5 kb with 40-100 bp terminal homologies were amplified from mouse BAC RP23-51O13 with Q5 polymerase (NEB, M0491L). Approximately equal amount (100 ng ...
-
bioRxiv - Immunology 2020Quote: CAR-encoding mRNA was transcribed from linearized plasmids encoding anti-human CD19 CAR61 and anti-mouse CD19 CAR71 using T7 RNA polymerase (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs). The mRNAs were transcribed to contain the 5′ UTR derived from the human a-globin 5′ leader RNA ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries were prepared according to the protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... Ribosomal RNA from 1000 ng total extracted RNA was depleted using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat; New England Biolabs Inc.). The remaining RNA was used to produce the sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc. ...
-
bioRxiv - Genomics 2023Quote: Mouse tail (1cm) was used to extract the genomic DNA (gDNA) using NEB Monarch® Genomic DNA Purification Kit (NEB T3010L). DNA concentration was measured on Qubit dsDNA BR assay kit (cat ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were washed three times with a PBS buffer 1X and then incubated with mouse anti-MBP (NEB, Cat# E8032L) or rabbit anti-V5 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared by amplifying the sgID-BC region from 32μg of genomic DNA per mouse using unique dual-indexed primers and the Q5 Ultra II 2x Master Mix (New England Biolabs, M0544X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2024Quote: The total RNA from the HG and LG treated βTC6 cells were rRNA depleted using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB), followed by fragmentation and the cDNA library preparation using the NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: DNAse-treated RNA with high RIN value was used to deplete ribosomal RNA using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6350) as per manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: For Southern blot analysis 150 ng of mouse DNA was digested with 10 units of BamHI-HF (NEB, Figure 2 and 5), NdeI (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... sgRNA target site mutation in mouse Thap1 cDNA was generated by Q5 Site-Directed Mutagenesis Kit (NEB, see Table S3 for primers). WT or Thap1-/-Brca1Δ11 MEFs (1 × 106 ...
-
bioRxiv - Microbiology 2021Quote: ... ribosomal RNA depletion was carried on the extracted RNA using Nebnext rRNA depletion kit (Human/mouse/rat) (New England BioLabs. In, USA). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... library was prepared using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA). The RNA-Seq libraries were sequenced on NextSeq 500 using the NextSeq 500/550 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... RNA-seq libraries were prepared from RNA samples (150ng) using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB Cat# E7405) in conjunction with NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB Cat# E7765) ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of genomic DNA were digested and loaded into each lane. Mouse (M. musculus and M. spretus) genomic DNA was digested with methylation-sensitive (HpyCH4IV, NEB cat. R0619L) or methylation-insensitive (ApoI ...
-
bioRxiv - Biochemistry 2023Quote: ... An mRNA transcript library for Illumina sequencing was created using the NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs, Ipswich, MA). A NextSeq 500 sequencer (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... 120 μg of total liver RNA was isolated from 60-100 mg liver tissue from each HDI-STARR-seq-treated mouse by TRIzol guanidinium thiocyanate-phenol-chloroform extraction then purified by polyA selection using oligo(dT) beads (New England Biolabs, cat. #E7490L). The purified RNA was digested with Turbo DNase-I (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... with rotation for 1 hour at room temperature followed by further incubation for 1 hour with the addition of 15 μl of goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA, USA). The magnetic beads in the supernatant were collected on a magnetic stand and washed 2 times with PBS ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using phenol-chloroform and subjected to ribosomal RNA removal using a NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB, Ipswich, MA). A RNAseq library was prepared by using a NEBNext® Ultra directional RNA library prep kit (NEB ...
-
bioRxiv - Physiology 2024Quote: ... for site-directed mutagenesis to generate nonsense mutations in mouse Mypbhl using Q5 Hot Start High-Fidelity (New England Biolabs, Cat No: M0494S). Plasmids were sequenced by Sanger reaction (Azenta Life Sciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixed RNA was depleted of rRNA using the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) and fragmented using NEBNext® Magnesium RNA Fragmentation Module (NEB, cat. no. E6150S) for 5 min ...