Labshake search
Citations for New England Biolabs :
951 - 1000 of 1251 citations for Recombinant Mouse Angiotensinogen serpin peptidase inhibitor clade A member 8 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 4.8 mM MgCl2 and 1x reaction buffer for T7 RNAP and 62.5 units of T7 RNAP (New England BioLabs, NEB). The mixture was incubated for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then ligated to pre-annealed double-stranded adaptors that contain single dT overhangs and a unique molecular identifier (UMI) consisting of a randomized 8-base sequence containing a 3-base specific barcode by T4 DNA ligase (NEB) overnight at 15 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 µL of the Klenow reactions were retrieved and added to 8 µL of 2x RNA Loading Dye (New England Biolabs). The mixtures were then analyzed by electrophoresis through a urea-15% polyacrylamide gel (Novex TBE-Urea gel 15% ...
-
bioRxiv - Genomics 2022Quote: ... Another half of the genomic DNA (less than 8 ng/μL) was treated with 0.2 unit/μL MseI (NEB, R0525S) for 1 hour at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5ul of PCR1 product as template was amplified using unique i5 and i7 index primer combinations with 8 cycles and Q5 High-Fidelity DNA Polymerase (NEB) for each individual sample to allow pooling of sequencing libraries ...
-
bioRxiv - Molecular Biology 2021Quote: ... 8 μg of digested nucleic acids were treated or not with 10 μl of RNase H (New England BioLabs, M029L) overnight at 37 °C in 1x RNAse H buffer and 1/10 of the samples were used as input ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 8 ug of <200nt RNA per sample was mixed to an equal volume of 2x loading dye (NEB #B0363A) and incubated at 70°C for 5min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Chromatin was then digested by adding 12 μl of 10x NEBuffer3.1 and 8 μl of 5 U/μl DpnII (NEB, R0543) followed by a 2h incubation at 37ºC in a ThermoMixer with shaking (900 rpm ...
-
bioRxiv - Immunology 2022Quote: ... 2018” tagmentation mix were either sorted into plates containing RCB buffer for condition “hiSDSprotK-TWEEN” (2 x RCB: 100 mM Tris-HCl pH 8, 100 mM NaCl, 40 µg/mL Proteinase K (NEB), 0.4 % SDS (Sigma ...
-
bioRxiv - Biophysics 2019Quote: ... 10 μl of 100 μM DNA oligos containing an amino group modification at their 5’ends were mixed with 8 μl of 20 mM BG-GLA-NHS (NEB) in 40 μl of 50 mM HEPES buffer containing 50% anhydrous DMSO ...
-
bioRxiv - Biophysics 2019Quote: ... final products were separated from non-ligated fragments by electrophoresis using a 0.8-1.5% (m/V) agarose gel and extracted from the gel with the Monarch® DNA Gel Extraction Kit (NEB).
-
bioRxiv - Physiology 2020Quote: ... RNA with RIN>8 was used to prepare transcriptomic libraries using the NEBNext Ultra RNA library prep kit (New England Biolabs). High throughput RNA-Sequencing was performed at the NIDDK Genomic Core Facility (NIH ...
-
bioRxiv - Biophysics 2019Quote: ... gels were gently removed from the chamber and digested overnight at 37 °C in 8 units mL−1 Proteinase K (NEB) diluted in digestion buffer (1× TAE buffer ...
-
bioRxiv - Physiology 2019Quote: ... Qualifying samples (samples with RNA integrity numbers > 8) were then prepared following the standard protocol for the NEBnext Ultra ii Stranded mRNA (New England Biolabs). Sequencing was performed on the Illumina NextSeq 500 with Paired End 42bp × 42bp reads ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mM CaCl2 was added and the His8 tag was cleaved through the addition of 8-16 U/mL enterokinase (New England Biolabs) for 2 days at 37°C ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs] ...
-
bioRxiv - Genomics 2021Quote: ... The PCR mix (8 µl H2O, 2 µl primer mix P5Solexa/P3Solexa, 10 µM each, 20 µl Phusion HF Mix [New England Biolabs]) was added to 10 µl cDNA ...
-
bioRxiv - Genomics 2021Quote: ... Fragmentation was carried out by adding 50 μL NEB Buffer 2 and 8 μL of 25 U/μL MboI restriction enzyme (New England Biolabs). Samples were incubated at 37 °C for 2 hours with rotation ...
-
bioRxiv - Biochemistry 2021Quote: ... Purified DNA was resuspended in 10 mM Tris pH 8 and prepared for sequencing using the NEBNext Ultra II DNA library kit for Illumina (New England Biolabs). Paired-end sequencing with 75 cycles and a 6-cycle index read was performed on the Illumina NextSeq500 system.
-
bioRxiv - Cancer Biology 2020Quote: ... 30 ng total RNA (RQI≥8) was used for library preparation following the NEBNext Ultra RNA Library Prep Kit for Illumina protocol (New England BioLabs) with the Poly(A ...
-
bioRxiv - Genomics 2020Quote: ... Zyagen samples were amplified with PBC096 barcoding for 8-10 cycles with both LongAmp (female, 62°C annealing; NEB, US) and PrimeSTAR GXL (male and female ...
-
bioRxiv - Genomics 2022Quote: Samples were digested by incubation in reverse-crosslinking buffer (50 mM Tris pH 8, 50 mM NaCl, 0.2% SDS) with 1:50 proteinase K (NEB P8107S) for 8-16 hours at 55°C ...
-
bioRxiv - Genomics 2022Quote: ... CRISPEY-BAR barcodes integrated in the genome were amplified with a first step PCR in 8 tubes of 50 uL reactions using Q5 hot-start DNA polymerase (New England Biolabs) following manufacturer recommendations ...
-
bioRxiv - Immunology 2022Quote: ... Iso-Seq libraries were generated using 500 ng high-quality (RIN > 8) RNA as input into oligo-dT primed cDNA synthesis (NEB). Barcoded primers were incorporated into the cDNA during second strand synthesis ...
-
bioRxiv - Neuroscience 2022Quote: ... The 5’ and 3’ arms (5 to 8 kb) were amplified from a C57Bl/6 BAC clone by PCR using Q5 polymerase (New England Biolabs) and inserted into a cloning vector that contains frt-flanked SV-Neo for positive selection and Pgk-DTA and HSV-TK genes for negative selection (Jarvie et al. ...
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Genomics 2024Quote: ... Genomic DNA was harvested by discarding culture media and adding lysis buffer consisting of 20 mM Tris pH 8 and 0.1% Triton X-100 (MilliporeSigma T9284) with 60 ng/mL of Proteinase K (New England Biolabs P8107S) added immediately prior to use ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted in 8 ml of T4 DNA ligase buffer 1X and incubated 8 hours at 16°C with 8000 Units of T4 DNA ligase (NEB). Crosslinks were reversed overnight at 60°C in the presence of proteinase K (0.125 mg / ml final ...
-
bioRxiv - Genomics 2023Quote: ... The resulting digested DNA (4 ml in total) was divided into four aliquots and diluted in 8 ml of ligation buffer (1X ligation buffer NEB without ATP ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... Recombinant Muc1 or lubricin mixed with one of the following enzymes: 8 unit/mL of proteinase K (P8107S, New England Biolabs), 500 μg/mL of pronase (10165921001 ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Coding sequences of ric-8 and nphp-2s were amplified from a mixed-stage N2 cDNA library using Phusion high-fidelity DNA polymerase (NEB) with gene-specific primers and verified by Sanger sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... was also reverse-transcribed and Illumina sequencing library prep was followed by 8–10 cycles of polymerase chain reaction (PCR) using High Fidelity Phusion (New England Biolabs). All the libraries were barcoded in the PCR step ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Genomics 2023Quote: ... Samples were diluted in 8 ml of T4 DNA ligase buffer 1X and incubated 8 hours at 16°C with 8000 Units of T4 DNA ligase (NEB). Crosslinks were reversed overnight at 60°C in the presence of proteinase K (0.125 mg / ml final ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve cDNAs were then serially diluted ten-fold from 10-1 to 10-8 and run through the SYBR Green assay (New England Biolabs) together with sample cDNAs ...
-
bioRxiv - Genomics 2023Quote: ... beads were incubated with 10 µL of USER mix (1 µL of 10X USER buffer and 1 µL of USER enzyme in 8 µL of nuclease-free water, NEB) and incubated at 37°C for 15 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... Each library was dissolved in 100µL Tris 10mM pH 8 and amplified by PCR with specific primers (Fw: GTGAACCGTCAGATCGCCTCGGCACTCCAGTCCT, Rv: AGAGGGTTAGGGATAGGCTTACCTCAGGCTAGTGCGGACCGAGTCG) using NEBNext Ultra II Q5 HotStart (NEB). PCR cycling parameters were set as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of genomic DNA (∼100 ng) was mixed with 8 µl of 1x Cutsmart buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of genomic DNA (∼100 ng) was mixed with 8 µl of 1x Cutsmart buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cancer Biology 2024Quote: ... perform 25-30 separate 100 µL reactions with 6-8 µg genomic DNA in each reaction using Q5 High-Fidelity DNA Polymerase (New England Biolabs) for around 18-20 cycles and then combine the resulting amplicons ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% SDS and 50 mM Tris-HCl and freshly added RNase inhibitor (#M03145, BioLabs), protease inhibitor (#5892953001 ...
-
bioRxiv - Genomics 2023Quote: ... and 30% for overnight at 4 °C) with RNase inhibitor [New England Biolabs (NEB), M0314L ...
-
bioRxiv - Genomics 2024Quote: ... 0.4 µL RNase Inhibitor and 2 µL Induro RT (200 U/µL; NEB M0681S) were incubated for 15 minutes at 60°C ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: Reverse transcription was performed by adding the following to the above reaction: 8 uL of 5x first strand buffer (NEB E7330L), 2 uL of 10mM dNTPs (each) ...
-
bioRxiv - Molecular Biology 2021Quote: ... was resuspended in 10x NEB CutSmart Buffer (8:1) and dephosphorylated by incubation with Quick calf intestinal phosphatase (CIP) (NEB, # M0525S) at 37 °C for 20 min ...
-
bioRxiv - Biochemistry 2020Quote: ... and 8 pmol of purified DNA was then used for in vitro transcription with T7 RNA polymerase (New England Biolabs Inc.). The resulting RNA was purified with Agencourt RNAClean XP beads supplemented with an additional 12% of PEG-8000 (3 volumes of 40% PEG-8000 was added to 7 volumes Agencourt RNAClean XP beads ...
-
bioRxiv - Synthetic Biology 2019Quote: Fly genomic DNA was isolated in a pool by grinding in 25 µl of “Squish Buffer” (10 mM Tris, 1 mM EDTA, 25 mM NaCl, 8 U/ml ProK (NEB P8107S)) per adult ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...