Labshake search
Citations for New England Biolabs :
1101 - 1150 of 1692 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: 3’ dephosphorylation was performed by incubating fragments with 10 U/uL T4 Polynucleotide Kinase (New England Biolabs M0201S) in the supplied buffer (NEB B0201S ...
-
bioRxiv - Neuroscience 2021Quote: NFIB 3’ UTR and 5’ UTR HP forming regions were in vitro transcribed using T7 transcriptase (NEB, E2040) and purified with Trizol extraction (described in RT-qPCR paragraph) ...
-
bioRxiv - Genomics 2020Quote: ... before and in between the following procedures: (1) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L), (2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 2-3 μg of source DNA plasmid (<10 kb) was added with NEBuffer 3.1 (NEB, cat# B7203S), DEPC ddH2O in a volume of 30 μl and incubated at 37 °C for >2 hour (h) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... This fragment was generated by a standard 3-step PCR protocol using Phusion DNA polymerase (New England Biolabs) and then cloned into the XbaI and HindIII sites of pEX18A (Prentki and Krisch ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fragmented RNA was then subjected to RNA 3’ linker ligation using T4 RNA Ligase I (New England Biolabs) and reverse transcription using a primer complementary to the linker sequence and SuperScript III (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Bioengineering 2020Quote: ... and the 3’ extension were ligated together into the digested vector using Quick Ligase or T4 Ligase (NEB) to generate the complete pegRNA plasmid ...
-
bioRxiv - Neuroscience 2019Quote: ... Ten microliters of PCR products were digested with Nsi1 (3 hours with 5 units of Nsi1 enzyme (NEB)) and then ...
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR was carried out using the primers in Supplementary Table 3 and Luna Universal qPCR Master Mix (NEB) in a BioRad iCycler in technical triplicates for each biological replicate ...
-
bioRxiv - Immunology 2021Quote: ... we modified the plasmid using primers EpMap_1 and EpMap_2 along with ssODN EpMap1_ssODN (Extended Data Table 3) using the NEBuilder Mastermix (NEB, E2621S) following the manufacturer’s instructions in order to create hairpin-free overlap regions that could be used for homology-based library cloning ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5µL of 10µM MBTUni-12 primer + 2.5µL of 10µM MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) + 10µL 5x HF Phusion Buffer + 1µL 10mM dNTPs mix (NEB #N0447S) + 0.5µL Phusion Polymerase + 28.5µL of Nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2020Quote: ... was added at 3’end of RA5) was ligated to RNA using T4 RNA ligase (New England Biolabs) at 25°C for 6 hr and 22°C for 6 hr ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Microbiology 2019Quote: The DNA oligo i116 that served as a 3’ adapter was adenylated using 5’ DNA Adenylation Kit (NEB), purified by ethanol precipitation as above and diluted to 10 μM with nuclease-free water.
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... and cloned between 300 bp of PCR amplified DNA fragments of the LdBPK_250018100.1 5’ and 3’ UTR using NEBuilder (NEB) inside pUC19 for construct amplification in E ...
-
bioRxiv - Molecular Biology 2021Quote: ... Promoters (Supplemental Figure 1, Supplemental Table 3) were amplified from genomic DNA using Q5 polymerase (New England Biolabs) and inserted between the enhancer and 24xMS2 sequences using restriction enzyme-mediated ligation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Homology arms and exon 3 of the murine Akr1b3 locus were amplified with Q5 polymerase (New England Biolabs) using genomic DNA from mouse R1 ES cells (23) ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM ATP and 3 units of T4 DNA ligase for 2 h at RT (all from NEB). Next ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and resuspended in 20 µl of 3’ end RNA dephosphorylation mixture (4 µl 5x PNK pH 6.5 buffer, 0.5 µl PNK [New England Biolabs; with 3’ phosphatase activity] ...
-
bioRxiv - Systems Biology 2021Quote: ... Adaptors for Illumina sequencing were added via PCR amplification using Nspacer_barseq_pHIMAR (Wetmore et al., 2015) and NEBNext Index 3 Primer for Illumina (New England Biolabs). Cycle conditions were 30 seconds 98°C followed by 4 cycles (15 seconds 98°C ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µL NEB Ultra II End-prep Enzyme Mix and 2 µL NEBNext FFPE DNA Repair Mix (NEB) were added to the DNA (final volume 60 µL) ...
-
bioRxiv - Genomics 2020Quote: ... The sample was then combined with 3’ RNA Ligase Master Mix (8μL 50% PEG 8000, 2μL 10x T4 RNA Ligase Buffer (B0216L, NEB), 1.5μL nuclease free water ...
-
bioRxiv - Molecular Biology 2021Quote: ... R: 5’-ccgggaaaaactgaaaaaccattggcacgacaggtttcccgac-3’ from the pKAM555 vector) was inserted at the ClaI site using HiFi assembly (NEB). For the intTEL0 strain creation the pUC19LG plasmid (lacking the PstI(blunted)-BclI fragment of the HARS36 sequence ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... Resulting supercoiled plasmid is linearized at the 3’ end of the PolyA tail using BamHI-HF (NEB R3136S), and checked for reaction completion by running on agarose gel ...
-
bioRxiv - Genetics 2020Quote: ... the mutant Tile 3 was subcloned into the full length AttB-KCNH2-HA:IRES:mCherry by restriction digest with BglII and NdeI (NEB) and ligation with T4 ligase (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: Ligation workups from the previous step were supplemented with 3 μL of 6X purple gel loading dye (NEB), heat denatured at 85 °C for 1 min ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the previously constructed genome-integrating vector pCS75 (25) (Supplementary Table 3) was cleaved with PmeI and EagI (NEB), the resulting fragments were separated on a 0.8% agarose gel ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was digested for 2-3 hours at 37°C with StuI or SphI restriction enzymes (NEB), as indicated in the figure legends ...
-
bioRxiv - Genetics 2022Quote: ... The second strand cDNA synthesis was performed using Klenow fragment 3’-5’ exo (New England Biolabs Inc, USA), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... A single adenine base was added to fragment ends by Klenow fragment (3′ to 5′ exo minus; NEB), followed by ligation of Illumina adaptors (Quick ligase ...
-
bioRxiv - Microbiology 2024Quote: ... 1.25 µL native ligation barcode (ONT SQK-NBD114-96) and 3 µL Blunt/TA Ligase Master Mix (NEB). The reaction was mixed by pipetting ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The ligations were transformed into high efficiency (1-3 × 109 CFU/μg pUC19 DNA) competent cells (NEB C3040). The transformations were serially diluted and plated on LB with ampicillin (100 μg/ml) ...
-
bioRxiv - Genomics 2023Quote: ... CBS 112042+ and CBS 124.78+ were sequenced on R9.4.1 flowcells using the LSK108 kit with 3 μg DNA as input for the end prep reaction (NEB ULTRA-II EP ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Genomics 2024Quote: ... 3.) Library preparation was performed using the NEBNext Ultra II library preparation kit for Illumina (New England Biolabs) and 4. ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 3’ A-addition and adapter ligation using a custom reagent formulation (New England BioLabs, E6000B-10). Libraries were pooled in equal molar amounts and were sequenced using an Illumina HiSeqX platform (Ilumina ...
-
bioRxiv - Molecular Biology 2023Quote: CDKN1A intron 1 APA 3’ splice site was deleted using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) as per the manufacturer’s instructions using forward primer (5’-TCCCCACCCCAAAATGACGCGCAGCC-3’ ...
-
bioRxiv - Genomics 2023Quote: ... nick ligation was then performed in a 30 µL reaction with 3 µL of 10x rCutSmart Buffer (NEB), 1.56 µL of 500 µM β-Nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ligation of the RNA 3’ Adapter (RA3) was achieved by using T4 RNA Ligase 1 (NEB, Ipswich, MA) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... At least 3 sgRNAs per gene were cloned using ssDNAs oligoes (IDT) and NEBuilder HiFi DNA Assembly (NEB) into modified backbone ...
-
bioRxiv - Microbiology 2023Quote: ... The 3′ ends of purified RNA were dephosphorylated with the addition of T4 PNK enzyme (New England Biolabs) and 10 mM ATP was added to phosphorylate the 5’ ends of the RPF (ribosome protected fragments) ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 µl of 100 mM dATP solution and 2.5 µl of Klenow Fragment (3′->5′ exo-) (NEB, #M0212L) were added to the mixture ...
-
bioRxiv - Microbiology 2023Quote: Purified vigR 3’ UTR amplified from JKD6008 was in vitro transcribed (IVT) using HiScribe T7 RNA polymerase (NEB). RNA products were DNase I treated (NEB ...