Labshake search
Citations for New England Biolabs :
901 - 950 of 1692 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were carried out in 10 μl of the purified components from the PURExpress In Vitro Protein Synthesis Kit (E6800S/L, NEB) with the corresponding templates ...
-
bioRxiv - Biochemistry 2019Quote: ... The digested PCR product was circularized by T4 DNA ligase in a total volume of 500 μL 1x T4 DNA Ligase Reaction Buffer containing 100 μL digested PCR product and 10 kU T4 DNA Ligase (NEB). The reaction was incubated overnight at 16°C and purified by ethanol precipitation ...
-
bioRxiv - Microbiology 2021Quote: ... The L-sNTurboID fragment was ligated back to the pCEZ-L backbone using the same restriction sites Pac1 and Hpa1 by NEB T4 ligase.
-
bioRxiv - Genomics 2020Quote: ... Each reaction is performed in 50 μl at 30°C overnight with 2 μl of circulated DNA with 2.5 μL of 10 μM (each) dNTPs (Catalog number: N0446S Vendor: New England Biolabs Inc), 2.5 μL Rolling cycle primer (10 μM) ...
-
bioRxiv - Microbiology 2021Quote: ... We then used a 1690 bp synthetic fragment (gBlock Gene Fragments from IDT) containing the digested L gene sequences and EGFP to be inserted by Gibson Assembly (NEBuilder HiFi DNA assembly, NEB). The gBlock contained mutations to replace nucleotides CT at rCDVRIVenus(6 ...
-
bioRxiv - Immunology 2021Quote: ... 10 μl of the eluted PCR product was used in a final indexing using NEBNext Multiplex Oligos for Illumina (E7710S, NEB) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... A 5 µL aliquot was taken in which primers and dNTPs were then inactivated using Exo-CIP Rapid PCR Cleanup Kit (NEB). From the resulting mixture ...
-
bioRxiv - Molecular Biology 2024Quote: ... adding nuclease-free water to a final volume of 1 L) with 1:1000 (vol/vol) proteinase K (New England Biolabs) at 37°C for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl from the PCR product were circularized using 1 µl T4 DNA ligase and 2 µl ligation buffer 10x (NEB) in a final volume of 20 µl ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl of the plasmid DNA served as template for a 50 µl PCR (Q5 High-Fidelity 2X Master Mix, NEB) with primers PK412+PK421 (input library ...
-
bioRxiv - Genomics 2023Quote: ... The nuclei were pelleted by centrifuging at 500 g for 5 min at 4 °C and resuspended in 200 μl 1X NEBuffer 2.1 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg/ml BSA; NEB, B7202) in a 1.5 ml tube ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified lysate was applied to Glutathione Sepharose 4B affinity resin (1 ml bed volume per 2 l culture; New England Biolabs), and incubated with rotation for
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μl of indexed P7 (Cao et al., 2017) and 20 μl of NEBNext High-Fidelity master mix (New England Biolabs) were added to each well and PCR performed as follows ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then reverse crosslinked and lysed by adding 10μL of 10X Lysis-T (250mM EDTA, 2M NaCl, 10% Triton X-100) and 4μL of proteinase K (NEB, P8107S) and incubating at 55°C for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L) following the kit protocol ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from 5-10 µl of the cell scrape and prepared for sequencing using the NEBNext Ultra II FS DNA Library Prep Kit (NEB) with the following modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 μL of ligation reaction mix was prepared (1X ligation buffer, 5 units of T4 RNA ligase I (New England Biolabs), 0.5 μL RNaseOut Ribonuclease inhibitor ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µl of the Dpn I digested amplification product was transformed into 25 µl of NEB turbo competent E.coli (NEB, C2984). The desired mutation was initially confirmed by Sanger sequencing (Genomics Core Facility (UPF ...
-
bioRxiv - Molecular Biology 2023Quote: ... Homology arms were cloned into pKLM73 for mNeonGreen and pKLM110 for mScarlet (gifts from Kara L. McKinley) using NEBuilder HiFi DNA Assembly (New England Biolabs). To generate knock-in lines ...
-
bioRxiv - Microbiology 2024Quote: ... NEBNext Ultra II DNA Library Prep Kit for Illumina with NEBNext Multiplex oligos for Illumina (NEB cat # E7645S/L; E6440) following the instruction manual (V6.1_5/20 ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was diluted to 3ng/µl and 2µl per sample were added to a well containing 10µl Luna Universal Probe qPCR Master Mix (New England Biolabs, M3004), 1.6µl forward/reverse cyp1a primer ...
-
bioRxiv - Cancer Biology 2024Quote: ... perform 25-30 separate 100 µL reactions with 6-8 µg genomic DNA in each reaction using Q5 High-Fidelity DNA Polymerase (New England Biolabs) for around 18-20 cycles and then combine the resulting amplicons ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L). The workflow was adapted to generate longer library fragments by reducing the fragmentation time (see manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 20 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 500 nM of each primer CCCTGTGGGTTTTACACTTAAAAAC and CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 10 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 1 µM of each primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L) as described for standard RNA-seq (42) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Genomics 2020Quote: ... 1 μL of 10 mM dATP and 15 units of Klenow 3’ → 5’ exo- (NEB M0212L) was added to blunted ends and incubated at 37°C for 30 minutes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 µl were used for amplification with Taq 2X Master Mix (New England Biolabs, Ipswitch, USA) using a 20-cycles PCR protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Genomics 2019Quote: ... was ligated to the 3’-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242L) in presence of PEG 8000 (2.5% w/v) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Approximately 1kb 5’ and 3’ Homology arms were assembled using HiFi DNA Assembly (New England Biolabs) upstream and downstream of this cassette with the following primers (5’-3’):
-
bioRxiv - Microbiology 2019Quote: ... 600 ng of total RNA were mixed with 0.83 μL 100 mM tris pH 7.5 and 0.17 μL 3 mg·mL−1 Random Primers (NEB) to a volume of 5.25 μL ...
-
bioRxiv - Physiology 2021Quote: ... RNA 3’ end dephosphorylation reaction consisted of T4 PNK (20 U/10 μL sample, NEB M0201S), SuperaseIn in 1X T4 PNK buffer without ATP for 60 min at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA from A549 cells (3 µg in 30 µl) was treated with RppH (NEB M0356) at 30 °C for 1 hr and purified by spin column ...
-
bioRxiv - Genomics 2020Quote: ... Fragmented RNAs were then dephosphorylated at their 3’ end using PNK (New England Biolabs, Cat: M0201) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...
-
bioRxiv - Biochemistry 2020Quote: ... Desalted peptides were dissolved at a concentration of 3 µg/µL in 1x CutSmart buffer (NEB, 50 mM potassium acetate ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Biophysics 2021Quote: Purified plasmids were digested at the 3’ end of the insert sequence with EcoRI-HF (NEB) to linearize the template with a 5’ overhang for in vitro transcription ...
-
bioRxiv - Genomics 2022Quote: ... 3 ug of input DNA was dephosphorylated with Quick CIP (New England Biolabs, cat no M0508). Following enzyme inactivation with alkaline phosphatase ...
-
bioRxiv - Bioengineering 2022Quote: ... NU-1707L) was added to the probes’ 3’ ends with Terminal Transferase (New England Biolabs, M0315L), which adds a single azido-dATP molecule ...
-
bioRxiv - Developmental Biology 2022Quote: ... Ribosome footprints were generated by incubating the lysate with 3 U/µg of micrococcal nuclease (NEB) for 40 min at 25° C ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Developmental Biology 2020Quote: ... The bcd-3’UTR was PCR amplified using Q5 high-fidelity polymerase (New England Biolabs, M0491S) from genomic DNA using the primers 5’-GAGTCATCA-TCATCAGTTTCGTCAAAAGTAACCTGGATGAGAGGCGTGTTAGAG-3’ and 5’-CTGGGTCG-GCGCGCCCACCCTTGTCTAGGTAGTTAGTCACAATTTACCCGAGTAGAGTAG-3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... rinsed with PBS and incubated in PBS containing 3% molecular biology grade BSA (New England Biolabs) and 0.05% Tween-20 for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Then the piggy-bac vector pPBhCMV1-miR(BsgI)-pA-3 was digested with BsgI (#R05559S, NEB) and the digested vector excised from a DNA agarose gel and the DNA purified ...
-
bioRxiv - Microbiology 2019Quote: ... for each sample 3 μg of DNase-digested RNA was treated with T4 Polynucleotide Kinase (NEB) for 1 h at 37 °C ...