Labshake search
Citations for New England Biolabs :
951 - 1000 of 1692 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... the 3’ ends of RNA fragments were dephosphorylated with T4 polynucleotide kinase (New England BioLabs #M0201S). A preadenylated DNA adaptor sequence was ligated to the 3’-hydroxyl ends of the RNA fragments using T4 RNA Ligase (T4 RNA Ligase 2 ...
-
bioRxiv - Genomics 2021Quote: ... dATP was added to the 3’ ends by adding 9μL of A-tailing mix (5μL NEB buffer 2.1 ...
-
bioRxiv - Genomics 2021Quote: dATP was added to the 3’ ends by adding 9μL of A-tailing mix (5μL NEB buffer 2.1 ...
-
bioRxiv - Genomics 2021Quote: ... followed by an overnight incubation at 16°C with 3 µL T4 DNA ligase (NEB, M0202). Samples were purified with phenol-chloroform and used as 3C templates for Taqman-qPCR ...
-
bioRxiv - Biochemistry 2021Quote: ... Concentrated medium was collected from the filters and 3 μl of PNGase F (New England Biolabs) was added to each sample then incubated at 37 °C for 24 h ...
-
bioRxiv - Biochemistry 2021Quote: ... media was replaced with media containing 3 µM SNAP-Cell block (New England BioLabs cat. # S9106S) and cells maintained at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA fragments were end-repaired and A-Tailed using Klenow fragment (3’-5-exo-) (NEB, M0212L), the DNA fragments were ligated to illumina adaptors (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3′ dA-tailed using NEBNext® Ultra™ II End Repair/dA-Tailing Module (NEB E7546L) and were purified with paramagnetic beads ...
-
bioRxiv - Genetics 2021Quote: ... Singlet and duplet pools were A-tailed using using Klenow HC 3’→5’ exo- (#M0212L; NEB).
-
bioRxiv - Cancer Biology 2020Quote: ... Positive control slides were treated with 3 U/mL DNase-1 (New England Biolabs, Cat. M0303) for 10 minutes at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... and a NEBNext Multiplex Oligos for Illumina (Index Primers Set 3) (Code E7710; New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... denatured and phosphorylated with 10 U of 3’-phosphatase-minus T4 polynucleotides kinase (New England Biolabs) at 37 °C for 30 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A deoxyadenosine triphosphate was added at each 3’end with the Klenow fragment (New England Biolabs), and (3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... About 3 µg of DNA from each sample was digested with two restriction enzymes (PstI; NEB catalog #R0140 and XhoI ...
-
bioRxiv - Cell Biology 2024Quote: ... newly deposited CENP-A was labelled with 3 µM SNAP-Cell® 647-siR (S910102S, NEB) for 30 mins before washing excess with media and allowing to grow for a further 30 mins ...
-
bioRxiv - Genomics 2024Quote: ... and pooled into 7 ml ligation buffer (1X ligation buffer 3 (New England Biolabs; without ATP), 1 mM ATP ...
-
bioRxiv - Bioengineering 2024Quote: ... The extracted DNA (3 μg) was fully digested with NcoI restriction enzyme (New England Biolabs, USA), separated in a 0.8% agarose gel and blotted onto a Hybond+ Nylon membrane (Amersham Biosciences) ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 μg of total RNA was reverse transcribed using LunaScript cDNA Synthesis Kit (New England Biolabs). Gene-expression levels were quantified by real-time quantitative PCR (iCycler iQ BioRad ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A deoxyadenosine triphosphate was added at each 3’end with the Klenow fragment (New England Biolabs). Illumina Truseq adapters (Affymetrix ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Genetics 2023Quote: ... then dATP was added to the 3′ ends of the DNA using Klenow exo-(NEB #M0212). The DNA was then subjected to double-sided SPRI bead size selection (AMPure XP beads ...
-
bioRxiv - Microbiology 2023Quote: ... Pre-adenylated L3-1R-App 3’ adaptors were ligated using T4 RNA ligase 1 (M0204, NEB) for 75 min at 25°C ...
-
bioRxiv - Biophysics 2022Quote: ... The gene sequences were flanked by restriction enzyme sites for 5’ NdeI and 3’ EcoRI (NEB). Genes were cloned into pET21a using standard protocols from NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ and 3’ homology arms and the insert were cloned into the pUC19 vector (NEB, #N3041S) by using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Buffer IIIb (3% Triton X-100, 1x T4 ligase buffer, 1x protease inhibitors; NEB, Sigma-Aldrich) was added to a final volume of 1 ml and sample was incubated for 15 min at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Buffer IIIb (3% Triton X-100, 1x T4 ligase buffer, 1x protease inhibitors; NEB, Sigma-Aldrich) was added to a final volume of 1 ml and sample was incubated for 15 min at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was ligated to the 3′ adaptor tRNA using T4 RNA ligase 2 (NEB, M0351L) for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by dA tailing with 0.25 U/µL Klenow (3′→5′ exo-) (New England Biolabs, M0212) in the presence of 0.5 mM dATP (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was 5’-labelled with 20 U of T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB # M0236S) and 50 pmol of (gamma-32P)ATP (Perkin Elmer ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 3% dimethyl sulphoxide (DMSO) and 0.4 U of Taq-Phusion High-Fidelity (New England Biolabs, USA). PCR conditions were as follows ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The 3′ end of isolated RNA was subsequently dephosphorylated using T4 polynucleotide kinase (New England Biolabs) at 37 °C for 1 hour based on the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 1μl XhoI digestion mix consisting of 5U XhoI restriction enzyme and 1 x NEB buffer 2.1 (New England Biolabs, Ipswich, Massachusetts), and 10 ng genomic DNA for iciHHV-6B samples or 200 ng DNA for non-iciHHV-6B samples.
-
bioRxiv - Microbiology 2021Quote: ... A screen for clones containing an insert into pBAD33 was carried out using 1 μl of this suspension as a PCR template using primers oMJD204 and oMJD205 and OneTaq Quickload 2X Master Mix (NEB, #M0486S), according to the manufacturer’s instructions (annealing temperature 45 °C ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... μl of eluted DNA from the previous digestion in 1x final concentration CutSmart buffer with 20 U SphI-HF (NEB R3182S). Digestion was carried out for 1 hour at 37 °C ...
-
bioRxiv - Genetics 2019Quote: ... 2 μl of genomic DNA was used as template in a 40 μL PCR reaction with LongAmp® Taq DNA Polymerase (NEB). The 415bp PCR fragment of white target was amplified with CGTTAGGGAGCCGATAAAGAGGTCATCC (w.sF ...
-
bioRxiv - Genetics 2020Quote: ChIP-seq libraries were built using the NEB Next UltraII DNA library Prep kit for Illumina (New England Biolabs #E7645S/L) and Agencourt Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Systems Biology 2022Quote: For INO80 replicate 1 and both input samples 20 μl of the eluted DNA was incubated with 30 μl of end-repair mix (0.66 mM dNTP mix (NEB, cat. # N0447S), 100 U/ml T4 DNA polymerase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 sorted cells were collected into individual wells of 96-well plate containing 5 μl of lysis buffer of NEB Next single-cell low input RNA library prep kit for Illumina (New England Biolabs #E6420). Plates were frozen immediately on dry ice and stored at −80 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... 2.5 µl 25 µM Custom Nextera PCR Primer 2 and 25 µl NEB Next High Fidelity 2x PCR Master Mix (NEB, #M0541) with 1 cycle of (72°C for 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μL of 10x SSS buffer and 1 μL of SSS Enzyme (NEBNext mRNA Second Strand Synthesis Module, New England Biolabs, USA) were added to the 17 μL of the purified sample ...
-
bioRxiv - Genetics 2020Quote: ... PCR amplifications were done in 5 μL volumes in a 384-format PCR plate using Q5® Hot-Start High-Fidelity 2x Master Mix (New England BioLabs, 2.5 μL per reaction for 1x concentration ...
-
bioRxiv - Genetics 2020Quote: ... 1μl of S2R+ or fly genomic DNA was used in a PCR reaction using Q5 High-Fidelity DNA Polymerase (NEB M0491L). Primer pairs (Supplemental File 2 ...
-
bioRxiv - Cell Biology 2020Quote: ... 200 ng/μL was used for subsequent reverse transcription assay with Luna® Universal One Step RT-qPCR kit (E3005, New England Biolabs) according manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Add 50 μl of 10X NEB Buffer 2 and 375 U (15 μl of 25 U/ μl) of MboI restriction enzyme (NEB, R0147), and digest chromatin for 2 hours at 37°C with rotation ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Microbiology 2022Quote: ... Purified RNAs were used for library preparation using the NEB Next Multiplex Small RNA Library Prep kit for Illumina (E7300 L) with Universal miRNA Cloning Linker from Biolabs (S1315S) as the 3’ adaptor and in-house designed indexed primers ...