Labshake search
Citations for New England Biolabs :
1301 - 1350 of 1692 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ and 3’ flanking sequences containing recognition sites for the Type II restriction enzyme BsaI-HF®v2 (NEB, R3733) were added to each IUPAC DNA block ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Genetics 2022Quote: ... then the single nucleotide (A) was added to the end of the digestive fragment by Klenow fragment (3’-5’ exo-) (NEB) with dATP at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Biochemistry 2020Quote: ... the human Rab1b 3-174aa (referred to as Rab1b)-encoding DNA was cloned into a modified pMAL vector (New England Biolabs), resulting in a construct with a N-terminal hexahistidine (6xHis ...
-
bioRxiv - Plant Biology 2021Quote: ... the RNA was subsequently ligated to an RNA adapter with a 3’ phosphate group by RtcB ligase (#M0458S, New England Biolabs). The ligated RNA was converted to cDNA with RevertAid first strand cDNA synthesis kit (#K1612 ...
-
bioRxiv - Microbiology 2021Quote: ... The protruding 3’ ‘A’ base was then used for ligation with the NEBNext Multiplex Oligos for Illumina (New England Biolabs) which have a single 3’ overhanging ‘T’ base and a hairpin structure ...
-
bioRxiv - Microbiology 2021Quote: ... From AF293 genomic DNA we amplified a ~4 kb fragment that included ~1kb 5’ and ~200 bp 3’ of sskA and introduced PacI and NotI (New England Biolabs) restriction sites at the 5’ and 3’ ends ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Neuroscience 2020Quote: ... according to the manufacturer’s recommendations and subjected to ligation (2h at RT) with a pre-adenylated 3’ linker (2µM final) and a truncated T4 ligase (NEB M0373L). Ligated RPFs of 50 – 70 nucleotides (nt ...
-
bioRxiv - Plant Biology 2021Quote: ... Flanking sequences 5’ and 3’ of the coding regions were amplified with appropriate primer pairs (Table S2) using Phusion DNA polymerase (New England Biolabs) and cloned into pDONR 221 P1-P4 and pDONR 221 P3-P2 ...
-
bioRxiv - Microbiology 2020Quote: ... Dephosphorylated RNA-protein complexes were then rinsed once with NT2 buffer and 3’-end ligated with T4 RNA Ligase 1 (NEB) overnight in an Eppendorf Thermomixer at 16°C ...
-
bioRxiv - Microbiology 2020Quote: ... A-tails were added to the 3′ ends of the DNA by incubating the beads with Klenow fragment (exo-) (NEB) in a 100 μL reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... Four hundred ng of total RNA extracted from pools of 250 mouse oocytes was ligated to 400 ng of P1 anchor primer (5’-P-GGT CAC CTT GAT CTG AAG C-NH2-3’) in a 10-µl reaction using T4 RNA ligase (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Microbiology 2022Quote: ... and poly(G) tails were added at the 3’ end of the purified ssDNA by terminal transferase (New England Biolabs). The double-stranded DNA was then synthesized and amplified by PCR from the poly(AG)-tailed ssDNA using the primers BLV-F2 and NV-oligo-dT-ADP1 and Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... 3’UTR fragment was assembled into a plasmid (VRQRABE-mRNA plasmid) using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Molecular Biology 2022Quote: ... 40 μL of each digest product were then ran on a 3% agarose gel and the appropriate band was gel extracted using a kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 40 μL of digest product was then ran on a 3% agarose gel and the appropriate band was gel extracted using a kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... single-stranded adaptors (5’-Phos – ATCCACAACAACTCTCCTCCTC – 3’) were linked to the AdSDV genome segments using T4 RNA ligase I (New England Biolabs). Using the reverse adaptor primer paired with another primer ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lyophilized peptides were resuspended in 200 µl of 50 mM ammonium bicarbonate to which 3 µl of PNGaseF (New England Biolabs) were added for a 4h incubation at 37C ...
-
bioRxiv - Microbiology 2019Quote: ... Individual fragments were designed that possessed 5’ and/or 3’ sequence homology to one another using Q5 high-fidelity DNA polymerase (New England Biolabs), followed by stitching the individual fragments together in a SOE reaction.
-
bioRxiv - Molecular Biology 2019Quote: ... Amplified vector and insert (1:3 ratio) were assembled in 20 µl Gibson reaction (61) as per manufacturer’s instructions (NEB, USA) and 2 µl was transformed into chemically competent E ...
-
bioRxiv - Cell Biology 2019Quote: ... we introduced flanking FRT sites 104bp upstream of the transcription start site and 99bp downstream of the end of the 3’UTR using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and the following primers:
-
bioRxiv - Cell Biology 2019Quote: ... the M2×24 array was cloned into the pUBC-HaloTag-bActinCDS-bActinUTR-MS2V5 using 20 bp of 5’ and 3’ homology to replace the MS2 cassette using the Hifi builder enzyme mix (NEB). This was later followed by further Gibson assembly of the Halo-bActinCDS-bActinUTR-M2×24 insert into the pLenti-puro backbone using NEB Hifi builder ...
-
bioRxiv - Molecular Biology 2019Quote: ... The resulting PCR product was ligated to the EcoRI-SbfI digested pLs-mP backbone in 3 separate Gibson assembly reactions (HiFi DNA Assembly, NEB). 2 µL of each Gibson assembly reaction were transformed into Stbl4 electrocompetent E ...
-
bioRxiv - Genomics 2019Quote: ... Ligation of pJDrcEPP_lib and minP-Luc2 inserts was performed at a 1:3 ratio as before but with T7 DNA ligase (New England Biolabs). Ligation product was cleaned-up and transformed as before ...
-
bioRxiv - Bioengineering 2019Quote: ... with 3, 6, or 12 nM iSpinach DNA (IDT, USA, Ultramers) template in transcription buffer (1x RNAPol Reaction Buffer (NEB, No ...
-
bioRxiv - Microbiology 2019Quote: ... followed by heat inactivation for 10 min at 80°C and overnight ligation at a 1:3 vector-to-insert ratio using T4 DNA Ligase (NEB) at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... To visualize SNAP-tagged dCENP-A proteins cells were labelled with 3 µM SNAP-Cell TMR Star (New England Biolabs) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... The AP-3 sorting mutant was regenerated in MigR1-PI4KIIα-GFP using the Q5 site-directed mutagenesis kit (New England Biolabs) following manufacturer’s instructions ...
-
Suppressing STAT3 activity protects the endothelial barrier from VEGF-mediated vascular permeabilitybioRxiv - Molecular Biology 2020Quote: ... to a final concentration of 0.1µg/ml was incubated with 3 µg purified STAT3 proteins as well as 5 µl ATP (New England Biolabs; N0440S) for 30 minutes at 30°C ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial lysis was completed by incubating for 3 h at 55°C in the presence of 1% SDS and 100 μg/ml proteinase K (NEB). Lysates from both methods were extracted twice with equal volumes of phenol– chloroform–isoamyl alcohol (25:24:1) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The targeted genomic locus was then PCR amplified with primers flanking the expected cutting site (Supplementary Table 3) using Q5 Hot Start High-Fidelity Polymerase (NEB). 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB) ...
-
bioRxiv - Plant Biology 2020Quote: ... epicentre cat # ER0720 or ER81050-we used this one) and A-tailing (100mM dATP; bioPioneer inc, Klenow; (3’-5’ exo- NEB) # M0212L (1,000 units ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... and YO-3009 (5’-ggg ccc acc ggt CGC CAG AAT GCG TTC GCA CAG CCG CCA GC-3’) and Q5 polymerase (NEB), then cloned into the SacI and AgeI sites of pSL1180/S17DN ...
-
bioRxiv - Microbiology 2020Quote: ... before resuspending the beads in 25 μl RNA ligation mix (9 μl H2O, 3 μl 10x T4 RNA ligase buffer (NEB), 0.3 μl 0.1M ATP ...
-
bioRxiv - Genomics 2020Quote: ... Purified fragments were mixed at 1:3 molar ratio and assembled with NEBuilder HiFi DNA Assembly Mater Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... was amplified by PCR using primers motAB-Fwd-KpnI and motAB-rev-SacI (Table S2) and ligated into plasmid pBBR1MCS-3 after restriction with enzymes SacI and KpnI (NEB). Ligation products were transformed into E ...
-
bioRxiv - Cell Biology 2019Quote: ... gR1 AIP5-3309 and gR2 AIP5-3309 primers were designed based on this tool and hybridized at a concentration of 3 µM in 1×T4 DNA ligase buffer (NEB) by initial heating and subsequent cooling steps ...
-
bioRxiv - Genetics 2019Quote: ... The repair templates were made by annealing oligos in Table S3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs). The pol30-6 (D41A ...
-
bioRxiv - Genomics 2019Quote: ... samples were digested with 10 U pshAI in 1x CutSmart buffer at 37°C for 3 or more hours (NEB).
-
bioRxiv - Molecular Biology 2019Quote: ... 100 pmol of the oligonucleotides 5’-ATTGTCATACCGATCCCAATTCGA-3’ and 5’-AAACTCGAATTGGGATCGGTATGAC-3’ were phosphorylated for 30 min at 37 °C using 1 mM ATP and 1 unit polynucleotide kinase (NEB) in the buffer supplied by the manufacturer and then hybridized in a thermocycler (5 min 95 °C ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was instead PCR amplified from pGADCg using forward primer AP36 and reverse primer AP38 (5’ GCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGcatctattgaagtaat aataggcgcatg 3’) and cloned into NotI- and XmaI-digested (NEB) pDest-AD-QZ213 via homologous recombination in yeast ...
-
bioRxiv - Genomics 2021Quote: ... a 5’ adenylated DNA oligonucleotide containing the complement of an Illumina Read 1 sequencing primer-binding site was then ligated to the 3’ cDNA end with Thermostable 5’ AppDNA / RNA Ligase (New England Biolabs). Properly ligated cDNAs were amplified by PCR (12 cycles ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Genetics 2020Quote: ... plasmid containing native 3’-UTRs were generated by excision of the 2xMyc-ADH1 3’-UTR from each RRP4/40-Myc LEU2 CEN6 plasmid by restriction digestion and cloning of the native RRP4 or RRP40 3’-UTR into each plasmid using NEBuilder HiFi Assembly (New England BioLabs).
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...