Labshake search
Citations for New England Biolabs :
1051 - 1100 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... The target loci were PCR amplified in 30 PCR cycles using Q5 High-Fidelity DNA Polymerase (New England Biolabs), locus-specific primer pairs (Supplementary Information ...
-
bioRxiv - Genomics 2023Quote: ... ATAC-seq libraries were prepared by ∼8 cycles of PCR using NEBNext High Fidelity 2X PCR Master Mix (NEB) and primers containing Illumina barcodes (Buenrostro et al ...
-
bioRxiv - Genomics 2023Quote: ... Accessible DNA libraries were amplified by PCR using NEBNext High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA), custom Nextera PCR primers as previously described (29) ...
-
bioRxiv - Plant Biology 2024Quote: ... The sequencing libraries were prepared by PCR amplification using the NEBNext PCR master mix (New England Biolabs, no. M0541S). The amplified libraries were purified with AMPure beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR reactions contained 2 μl cDNA in 50 μl PCR reaction with Phusion Hot Start Flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Addgene cat#52961) by PCR amplification using NEB Next High-Fidelity PCR Master Mix (New England Biolabs, cat#M0541S). The PCR product was digested with Esp3I (BsmBI ...
-
bioRxiv - Molecular Biology 2022Quote: ... then quantified with the NEBNext® Library Quant Kit for Illumina® using qPCR on a StepOne Plus real-time PCR platform (New England Biolabs® Inc., MA, USA). Following qPCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA library yield was increased by a further round of PCR with Post LM-PCR oligos (Nimblegen) and Q5 High-Fidelity DNA polymerase (NEB). The PCR reaction consisted of 30 μl of the mono or di nucleosomal DNA libraries (150270 ng) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were amplified for 12 PCR cycles with unique dual index primers using the NEBNext Hi-Fi 2X PCR Master Mix (New England Biolabs). Amplified libraries were purified using a 1.2X ratio of Axygen magnetic beads (Corning Inc ...
-
bioRxiv - Microbiology 2022Quote: ... and amplicons were generated by PCR (primers 341F and 806R) using a Phusion High-Fidelity PCR Master Mix (New England Biolabs). Amplification product quality was assessed by gel electrophoreses and samples were pooled in equimolar ratios ...
-
bioRxiv - Genomics 2020Quote: ... 2.5uL reverse PCR primer (CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT) and 25uL NEBnext High-Fidelity 2x PCR Master Mix (New England Biolabs, MA, United States)) using thermo-cycler conditions described in 94 for a total of 9 cycles ...
-
bioRxiv - Immunology 2020Quote: ... The whole resulting product was then PCR-amplified using indexed primers with NEBNext High-Fidelity 2X PCR Master Mix (NEB). First ...
-
bioRxiv - Bioengineering 2019Quote: VIM-T2A-mCardinal sequence was cloned from cDNA of knocked-in cells upon PCR amplification into linearized by PCR pmR expressing vector (Clonetech) and recombined using Gibson Assembly reagent (NEB). Resulting vector contained full VIM-T2A-mCardinal reading frame under the control of CMV promoter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... of HIV env was amplified using a nested PCR approach with Phusion High-Fidelity PCR Master Mix (New England Biolabs). The outer primers were ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed in 1X Phusion® High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs M0531) and PCR cycling at 98°C for 30s ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed in 20 uL 1X Phusion® High-Fidelity PCR Master Mix with HF Buffer (NEB M0531) and using touchdown PCR cycling at 98°C for 30s ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR products were gel-purified and used for a second round of PCR amplification (Q5 NEB master mix, 7 cycles) using custom primers to attach Illumina read sequences ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tagmented DNA was amplified with 12 cycles of PCR using the NEBNext Hi-Fi 2X PCR Master Mix (NEB M0541) and unique dual index primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then amplified by PCR using custom nextera primers at 400 nM and NEBNext HiFi 2x PCR Master Mix (New England Biolabs) (Buenrostro et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The ORF was removed by inverse PCR to generate the genomic deletion vector (P5/P6) and plasmid recircularized from PCR product (KLD enzyme blend, NEB).
-
bioRxiv - Microbiology 2022Quote: ... DNA library was prepared by PCR amplification using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England BioLabs). The resulting PCR products were purified by QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR reactions were carried out with 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs); 0.2 μM each of forward and reverse primers ...
-
bioRxiv - Microbiology 2020Quote: ... Eluted cDNA was transferred to a new PCR tube containing 15 μL of 2X Phusion HF-PCR Master Mix (NEB), 0.5 μL of 30 μM P3/P6 PCR1 oligo mix and 0.5 μl of 15x SYBR Green I (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... Virus titer was determined using SYBR-based one step qRT-PCR with Luna Universal One Step qRT-PCR reagent (NEB). QuantStudio 5 (Applied Biosystems ...
-
bioRxiv - Genetics 2022Quote: ... The resulting PCR products were used in a PCR to add Gateway attB sites: 25 µL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 1 µL PCR product ...
-
bioRxiv - Immunology 2022Quote: All CER constructs were generated by standard PCR cloning techniques and the PCR products were assembled using the NEBuilder HiFi DNA Assembly (New England Biolabs). CER21 was generated by linking the extracellular and transmembrane domain of human TIM-4 (GenBank™ accession number AAH08988.1 ...
-
bioRxiv - Genetics 2019Quote: ... and joined in a single step by overlap extension PCR (1st step: equimolar mix of PCR fragments ZEO, HR and HL, NEB Q5 high-fidelity 2X master mix ...
-
bioRxiv - Immunology 2019Quote: ... TCR amplification was achieved by performing two rounds of nested PCR using Phusion High-Fidelity PCR Master Mix (New England Biolabs). During the first PCR priming ...
-
bioRxiv - Genomics 2019Quote: ... 128 ng of this mixture was used per PCR with NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) along with the reverse-transcriptase primer (Creb_Hand_RT ...
-
bioRxiv - Genomics 2019Quote: ... This volume was distributed across 14 replicates per technical replicate so as to not exceed 10% of the total PCR volume and amplified using NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) with the primers P5_Seq_Luc_F and P7_Ind_##_Han ...
-
bioRxiv - Developmental Biology 2020Quote: ... We tested all primers using 1uL of genomic DNA from H9 human ES cells in a PCR reaction containing 12.5 uL Phusion High Fidelity PCR Master Mix (NEB, M0531L), 1.25 uL 5 uM forward primer ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1ul of cDNA was amplified by PCR with primers that amplify about 200 bp surrounding the sites of interest using OneTaq PCR Mix (NEB). The numbers of cycles were tested to ensure that they fell within the linear phase of amplification ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1ul of cDNA was amplified by PCR with primers that amplify about 200 bp surrounding the sites of interest using OneTaq PCR Mix (NEB). The numbers of cycles were tested to ensure that they fell within the linear phase of amplification ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Cell Biology 2021Quote: Site-directed mutagenesis of pLenti-CMV-Neo-PINK1 (C125G)-EYFP or pLVX-puro-OMA1 (E328Q)-EYFP was performed by PCR amplification (CloneAmp HiFi PCR Premix, Takara or Q5 High-Fidelity DNA Polymerase system, NEB) of PINK1 or OMA1 encoding plasmid using appropriate primers followed by Gibson assembly (In-Fusion HD Cloning system ...
-
bioRxiv - Cell Biology 2021Quote: ... 319 bp and 201 for the heterozygous vclb mutants and PCR products of 490 bp and 319 bp for homozygous vclb mutants PCR was performed using OneTaq DNA polymerase (NEB) and PCR products were loaded on a 1% agarose gel to assess the genotype (see Supplementary Figure 2).
-
bioRxiv - Genomics 2021Quote: ... was amplified and barcoded in parallel using the same PCR program in 50 μL PCR reaction (2 μL gap-repaired DNA, 25 μL 2× NEBNext High-Fidelity PCR Master Mix (NEB), 1.5 μL 10 μM i5 universal PCR primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... A 200-275 base pair region containing the relevant sgRNA target sequence was PCR-amplified from genomic DNA using the NEBNext High-Fidelity 2X PCR Master Mix (New England BioLabs) in a 25 µL PCR reaction volume (primer sequences appear below) ...
-
bioRxiv - Genomics 2022Quote: ... Transposed DNA fragments were amplified for 13 cycles in the presence of Custom Nextera PCR primers (Buenrostro et al., 2013) using the NEBNext High-Fidelity 2x PCR Master Mix (Cat. #M0541, New England Biolabs). Libraries were purified using the High Pure PCR Production Purification Kit (11732676001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by a single-cycle of PCR using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs) (98°C for 10 sec pre-denaturation followed by 98°C for 5 sec ...
-
bioRxiv - Molecular Biology 2022Quote: ... Illumina multiplex and bar code primers were added by PCR (1 µL of MMEJ product and 200 nM primers in Phusion High-Fidelity PCR Master Mix (New England Biolabs) with 98°C ...
-
bioRxiv - Genetics 2022Quote: ... DNA of Del1 and Del2 from Family 1 were used to amplify different haplotypic fragments with long-range PCR or TD-PCR (Table S17) adding restriction enzymes (MluI and KpnI, NEB) on the 3’ of primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... We generated cDNA with random hexamers for qRT-PCR) or oligo(dT) primers for RT-PCR using M-MLV (NEB). We carried out semi-quantitative RT-PCR using DreamTaq (Thermo Fisher) ...
-
bioRxiv - Genetics 2022Quote: ... The two PCR fragments were PCR-stitched with primers B1012 and B1366 and inserted by NEBuilder HiFi DNA Assembly (New England Biolabs) into MluI of pBN523 ...
-
bioRxiv - Microbiology 2023Quote: ... The two flanking regions of the chosen genomic exchange region were amplified and joined with PCR fragment carrying antibiotic resistance cassette by overlapping PCR using Q5 polymerase (New England BioLabs). Next ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA corresponding to selected and diversity control samples were PCR amplified with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs) as described in20 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 25 uL of 2xphusion PCR mastermix (Phusion High-Fidelity PCR Master Mix with HF Buffer – 100 rxns, NEB, cat #M0531S), 0.625uL of 100uM F primer ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of cDNA was used in a 50 μl PCR reaction containing 1 μl of 10 μM PCR primer and 25 μl of 2x LongAmp Taq Master mix (NEB). PCR was performed as shown in Supplementary Protocol ...