Labshake search
Citations for New England Biolabs :
1301 - 1350 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and PCR was performed using Q5 polymerase (NEB; M0491L) with primers that had 500 bp homology to both KPPR1S and MKP103 on either end of the transposon cassette ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Enzymes for PCR and cloning were purchased from NEB. Plasmids were cloned into either Top10 E ...
-
bioRxiv - Synthetic Biology 2019Quote: ... by PCR (NEB, Q5® High-Fidelity DNA Polymerase). The other promoters (PALD4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The substrates were amplified using Phusion Polymerase PCR (NEB). The linear double-stranded molecules were denatured and renatured to produce both the parental linear molecules and a circle with nicks on each strand nearly half-way around the circle which were then ligated by Taq Ligase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: PCR products were run alongside 100bp ladder (NEB, N3231L) on a 1.2% agarose gel prestained with SYBR Safe (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... PCR amplification was performed using a Q5 polymerase (NEB) and an CH1-specific reverse primer (5’ATGGAGTCGGGAAGGAAGTC’3 (Ozawa et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were first treated with DpnI (NEB, R0176) and T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR-reaction was treated with DpnI (NEB CutSmart) to get rid of the template DNA ...
-
bioRxiv - Systems Biology 2021Quote: ... using 2X NEBNext High-Fidelity PCR Master Mix (NEB). For sequencing ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Both PCR reactions were digested with DpnI (NEB, USA) for one hour at 37°C and then purified using the MagJET NGS Cleanup Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplification was conducted using Phusion HF reagents (NEB) and employed the following cycling conditions ...
-
bioRxiv - Genetics 2020Quote: PCR mixture per reaction: 10 µl HF Buffer (NEB), 1.25 µl 10-µM forward primer ...
-
bioRxiv - Systems Biology 2019Quote: ... The PCR reaction was digested with 10U DpnI (NEB) for 1h at 37°C and purified by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2020Quote: PCR-1 reactions were performed using Q5 Polymerase (NEB) in a 20 μl reaction containing 200 μM dNTPs ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were digested with BsaI (New England Biolabs) followed by gel purification and ligation into respective entry vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was PCR amplified with Phusion polymerase (NEB #M0531S), run on an agarose gel ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR reactions were conducted using Phusion polymerase (NEB) according to the manufacturer’s instructions with GC buffer ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplifications were made with Phusion polymerase (NewEngland Biolabs) under the standard reaction protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR product was purified on silica columns (NEB T1034) and assembly with Nluc_HBB_3UTR fragment was performed as described above for initial preparation of IVT template using HBB29_N35 amplicon ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR product was purified on silica columns (NEB T1034) and amplified with under the following conditions ...
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.
-
bioRxiv - Cell Biology 2019Quote: ... PCRs were performed using Taq Polymerase (NEB standard protocol) and the following amplification conditions ...
-
bioRxiv - Genetics 2020Quote: ... The HeLa Deletion Reporter required PCR with OneTaq (NEB) using the high GC content additive to amplify through the very GC-rich CAG sequence ...
-
bioRxiv - Microbiology 2019Quote: ... PCR was performed using Phusion High Fidelity polymerase (NEB) after which PCR products were run on a 1.2% or 2% agarose gel ...
-
bioRxiv - Microbiology 2021Quote: ... The backbone PCR products were subjected to DpnI (NEB) digestion ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were prepared with OneTaq Master-mix (NEB) in 96 well plates to a final volume of 20μl ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR amplicon was digested with Nde I (NEB) and Xho I (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR fragments were obtained using Phusion polymerase (NEB M0530L) with 37 cycles at 98°C for 30s ...
-
bioRxiv - Immunology 2021Quote: ... The PCR was performed using Phusion DNA polymerase (NEB) and DMSO 10% ...
-
bioRxiv - Immunology 2020Quote: ... PCR products were digested by Dnp1 (New England Biolabs). After Quick Change ...
-
bioRxiv - Cell Biology 2021Quote: ... The clones were then screened by PCR (Q5-NEB) and amplified to be further analysed by western blot.
-
bioRxiv - Cancer Biology 2021Quote: ... The radiolabeled PCR product was digested with PstI (NEB) for 2 hrs at 37 °C to distinguish PKM1 (undigested ...
-
bioRxiv - Immunology 2021Quote: ... directly into One Step RT-PCR reaction mix (NEB) loaded in MicroAmp Optical 96-well reaction plates (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was digested with Kpn I (NEB) and Hind III (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... All PCRs were performed using Phusion DNA polymerase (NEB). Molecular cloning was performed using HiFi DNA Assembly (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR reactions utilizing Q5 (New England Biolabs cat # M0492L), a high-fidelity DNA polymerase ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was PCR amplified using NEBNext High-Fidelity (NEB, M0541 ...
-
bioRxiv - Immunology 2022Quote: ... The targeted gene region was amplified by PCR (NEB Next High-Fidelity 2xPCR Master Mix ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were cleaned using Exo-CIP™ (NEB) and sequenced on an ABI 8730XL with BigDye Taq FS Terminator V3.1 (University of Pennsylvania ...
-
bioRxiv - Systems Biology 2023Quote: ... gDNA was amplified by PCR with Phusion polymerase (NEB) using primers CAAGCAGAAGACGGCATACGAGAT -i7 - GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCACTGCTAGCTAGATGACTAAACGCG and AATGATACGGCGACCACCGAGATCTACAC - i5 - ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGGTCTGGATCCACCGGTCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were circularized with T4 kinase (NEB, M0201L) and T4 ligase (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Colony PCR reactions were performed with Taq polymerase (NEB). QiaQuick PCR purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μL NEBNext HiFi 2 × PCR Master mix (NEB) was added ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The PCR product was incubated with DpnI (NEB, USA) in 1 hour at 37°C to digest the template plasmid.
-
bioRxiv - Microbiology 2022Quote: ... whereas diagnostic PCR used standard Taq DNA polymerase (NEB).
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were purified by gel extraction (NEB, T1020) and sequenced on a NextSeq 500 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions were performed using Q5 DNA polymerase (NEB) or PrimeSTAR MAX (Takara) ...
-
bioRxiv - Microbiology 2023Quote: ... Diagnostic PCRs were performed with OneTaq DNA polymerase (NEB) or GoTaq DNA polymerase (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were purified by gel extraction (NEB, T1020) and sequenced on a NextSeq 500 (Illumina ...