Labshake search
Citations for New England Biolabs :
9951 - 10000 of 10000+ citations for Mouse Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Introduction of the overlapping BREX/AluI site to the pHERD30t vector was also achieved via Q5 site-directed mutagenesis kit (NEB). Plasmids were transformed into chemically competent XL1-Blue cells (Evrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: Visible LEAP bands were excised from agarose gels and cDNAs were purified using the Monarch DNA Gel Extraction Kit (NEB). Purified DNAs from excised gel slices were cloned into a pCR4Blunt-TOPO vector using a Zero Blunt TOPO PCR Cloning Kit for Sequencing (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA pellet was resuspended in 50 µl of RNase-free H2O and 1 µl of the resuspended samples was used for quantification of the DENV-2 D220 NS5 RNA regions using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 10-ul reaction volume ...
-
bioRxiv - Microbiology 2024Quote: ... and its variant CjeNThr69Ser77Thr111his6 were cloned into pET21a(+) plasmid using a NEBuilder HiFi DNA assembly cloning kit (New England Biolabs). The proteins were overexpressed in E ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA fragments were subject to end-repair and dA-tailing with NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs), followed by ligation with 50 pmol of adaptor 1 (Ad1 ...
-
bioRxiv - Microbiology 2024Quote: ... This dimer was introduced into pBECAb-apr using the NEBridge Golden Gate Assembly Kit (New England Biolabs, Ipswich, MA, USA) to generate pBECAb-apr-kmtA ...
-
bioRxiv - Cell Biology 2024Quote: Mutations in RAD54L were generated in pENTR1A-RAD54L-HA (31) using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) (Table S4) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 300 ng of genomic DNA and used the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) to prepare the libraries ...
-
bioRxiv - Microbiology 2024Quote: ... according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB). Library molarity was measured with the Qubit DNAds HS assay kit from Invitrogen and the quality was analyzed using Bioanalyzer DNA Analysis kit (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... GDNA was isolated from 7 dpf efemp1+/+ or efemp12C-Cas9 zebrafish eyes using a Monarch Genomic DNA Purification Kit (T3010S; NEB) and quantified using a Nanodrop 1000 (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: PCR products amplifying the C-terminal region of CBP in both edited and unedited cells were cleaned up using the Monarch PCR cleanup kit (NEB). DNA concentrations were measured using the Qubit dsDNA BR kit (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L) as described for standard RNA-seq (42) ...
-
bioRxiv - Microbiology 2024Quote: ... was amplified using primers OVL7966 and OVL6481 and the PCR product was excised from a 2% agarose gel using the Monarch DNA cleanup and gel extraction kit (NEB). One-step Golden Gate Assembly (GGA ...
-
bioRxiv - Microbiology 2024Quote: DNA sequencing libraries were prepared from ChIP-seq and Input DNA samples using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: Site-directed mutagenesis was performed on human HMGCR transcript 1 coding sequence in the pCMV-SPORT6 backbone to generate the variants of interest using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). pCMV-SPORT6-hHMGCR1 was a gift from Anne Galy (Addgene plasmid # 86085 ...
-
bioRxiv - Microbiology 2024Quote: ... The amplification product of pan-CoV semi-nested PCR was purified and concentrated by the Monarch PCR & DNA Cleanup Kit (NEB), according to the protocol supplied ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Synthesized modRNA was column purified and eluted with 60 µL water using the 50 µg Monarch RNA Cleanup Kit (New England Biolabs). A small sample was nanodropped and ran on a native denaturing gel to determine RNA concentration and verify full-length product ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 200 ng of purified product was used in a 20 µL IVT reaction using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), fully substituting UTP with N1-methylpseudouridine-5’-phosphate (TriLink Biotechnologies ...
-
bioRxiv - Plant Biology 2024Quote: RNA for direct RNA sequencing was extracted from one white petal with the Monarch Total RNA miniprep Kit (New England BioLabs) combined with the manufacturer specific DNase treatment ...
-
bioRxiv - Microbiology 2020Quote: The real-time PCR technique was performed for NDV detection using Luna Universal One-Step RT-qPCR Kit E3005E (New England BioLabs, USA) following the manufacture procedures ...
-
bioRxiv - Plant Biology 2020Quote: ... YFP and CESA6 genomic sequence through Gibson Assembly method using a Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA). The construct was verified by DNA sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µl of extracted RNA was used in a TaqMan one-step qRT/PCR assay (Luna® Universal One-Step RT-qPCR Kit, NEB). TaqMan analysis was carried out with primer/probe combination described in Table 1 and analysis performed on the QuantStudio™ 6 Flex System (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Cell Biology 2019Quote: ... and UBA domain (L309D, M332K/Y334F, and ΔYFLLL) mutants were generated using Q5 Hot Start Site Direct Mutagenesis kit (New England BioLabs, E0552S). BRSK2 domain deletion mutations ΔN (Δ kinase) ...
-
bioRxiv - Cell Biology 2020Quote: ... the pT7-SVmCherry plasmid was first linearised with XhoI and used as a template for in vitro RNA transcription with HiScribe T7 ARCA mRNA kit (New England Biolabs, #E2065S). Transcribed genomic RNA was transfected into BHK-21 using Lipofectamine 2000 reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression of mRNA transcripts for PfRFC1 gene analysis were carried out using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Inc.), on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: E248R deletion mutant proteins of distinct domains (Δ constructs) were generated from E248R WT plasmid by site direct mutagenesis using the Q5 mutagenesis kit (New England Biolabs) as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... The presence of the PCR products was confirmed by gel electrophoresis and the products were then purified by Monarch® PCR & DNA Cleanup Kit (New England Biolabs).
-
bioRxiv - Genetics 2021Quote: For CUT&RUN-sequencing libraries were made starting from 10 ng of CUT&RUN DNA fragments using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S) using the following PCR program ...
-
bioRxiv - Genetics 2021Quote: ... DNase libraries were prepared for sequencing using NEBNext Ultra II DNA Library Prep Kit for Illumina following the manufacturer’s instructions (NEB, cat. # E7645), with double-sided SPRI size selection (Agencourt AMPure XP beads ...
-
bioRxiv - Genetics 2021Quote: ... and a 50-μl aliquot containing between 832-841 ng was provide to the KU Genome Sequencing Core for library construction using the NEBNext Ultra II DNA Library Prep Kit (NEB, E7645L), incorporating unique dual-indexing (NEB ...
-
bioRxiv - Genetics 2021Quote: ... We converted oligo(dT)-selected RNA into a cDNA library for mRNA sequencing using the NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (NEB) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... 50 ng of m6A-containing mRNAs or pre-immunoprecipitated mRNAs (the input) were used for library construction by the NEBNext ultra RNA library preparation kit (NEB, E7530). High-throughput sequencing was conducted on the illumina HiSeq X sequencer with a paired-end read length of 150 bp following the standard protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sequencing libraries were made using the NEB Next Ultra II DNA library kit (New England BioLabs Inc, Ipswich, MA, Cat #E7645S) and were sequenced on the Illumina Hi-Seq4000 using 50bp single-end reads at the Northwestern Sequencing Core (NUCore).
-
bioRxiv - Microbiology 2021Quote: ... A plasmid encoding an eGFP-containing EBOV antigenome was generated through assembly of fragments using the NEBuilder HiFi DNA assembly cloning kit (New England Biolabs (NEB)) ...
-
bioRxiv - Microbiology 2019Quote: ... Sequencing libraries were generated using the resulting ribosomal transcript-depleted RNA and NEBNext Ultra II Directional RNA Library Prep Kit (NEB, USA) according to the manufacturers’ protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolab E7420L) and NEBnext Multiplex Oligos for Illumina Dual Index Primers (New England Biolabs E7600S), using provided protocols and 500 ng of total RNA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... corresponding to a partial ASY3 DEL allele was excised and purified with a Monarch® DNA Gel Extraction kit (New England Biolabs). Purified PCR products were cloned into pCR™4-TOPO® vector using a TOPO™ TA Cloning™ for Sequencing Kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared with 50 ng of DNA using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs®) as per the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA libraries for RNAseq analysis were prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) and NEBNext rRNA Depletion Kit (Human/Mouse/Rat ...
-
bioRxiv - Developmental Biology 2020Quote: ... A 250-300 bp insert cDNA library was generated by using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, E7530S). Transcriptome sequencing was performed on an Illumina NovaSeq 6000 ...
-
bioRxiv - Immunology 2021Quote: ... Illumina adaptors were ligated using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (New England BioLabs, USA) according to the manufacturer’s protocol and sequencing in the Illumina platform with the PE150 mode ...
-
bioRxiv - Developmental Biology 2021Quote: ... Library preparation (from precipitated material and input chromatin as control) was performed using NEBNext Ultra II DNA library Prep Kit (New England Biolabs, #E7645S) without size-selection to maintain sample complexity and according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... The purified rRNA-depleted samples were converted to cDNA as per the NEBNext ultra II RNA library prep kit for Illumina (NEB, E7770L). Total RNA from the rest of the samples was converted to cDNA according to the ARTIC amplicon sequencing protocol for SARS-CoV-2.artic ARTIC protocol primer artic schemes for SARS-CoV-2 (Version 2 ...
-
bioRxiv - Microbiology 2022Quote: ... RNA-seq libraries were generated using the NEBNext Ultra Directional RNA Library Prep kit for Illumina with NEBNext® Poly(A) mRNA Magnetic Isolation Module (both New England BioLabs). Samples were adjusted to 400 ng total RNA and spiked with diluted 1/100 ERCC Spike-In Mix (4456740 ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA preparations were then used directly for qPCR (200 ng total RNA per reaction) using the Luna Universal One-Step RT-qPCR Kit (NEB, E3006) and target-specific primer/probe sets (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... was used to generate RNA-seq libraries using the NEBNext Ultra Directional RNA library Prep Kit for Illumina (New England BioLabs, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Hippocampus RNA-seq libraries were prepared in accordance with New England Biolab protocols (NEBNext_ Ultra II RNA library Prep kit for Illumina, NEB, USA). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 ng of two replicates each of AbmR co-purified RNA and rRNA-depleted induced E.coli control RNA were converted into RNA-seq libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, USA) per the manufacturer’s instructions ...