Labshake search
Citations for New England Biolabs :
9751 - 9800 of 10000+ citations for Mouse Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were generated according to the manufacturer’s instructions: polyA-selected RNA was isolated and libraries were prepared using the NEBNext kit (New England Biolabs, e7500s). Purified libraries were quantified on an Agilent Technologies 2200 TapeStation with a D1000 ScreenTape assay ...
-
bioRxiv - Microbiology 2023Quote: ... The amount of RNA template was equalized for reverse transcription using the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs) and random hexamers ...
-
bioRxiv - Microbiology 2023Quote: ... Library preparation was conducted by the standard ≥100 ng protocol from the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) with minor modifications ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by first-strand cDNA synthesis with the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs) and NEBNext Multiplex Oligo for Illumina (New England Biolabs ...
-
bioRxiv - Plant Biology 2023Quote: The EYFP reporter constructs for nuclear localization were created by bridging the linearized proGL2:EYFP SR54 binary vector lacking the GL2 cDNA with ssDNA oligos using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs) and oligonucleotides given in Supplemental Table S3 ...
-
bioRxiv - Plant Biology 2023Quote: circRNAs were produced by in-vitro transcription from annealed DNA oligonucleotide templates (Table S2) using HighScribe T7 high-yield RNA synthesis kit (NEB) along with ATP ...
-
bioRxiv - Plant Biology 2023Quote: ChIP-seq libraries were constructed from 100 ng of DNA samples using the NEB Ultra II DNA Library Prep Kit for Illumina (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: Site direct mutagenesis of GPS1 (plasmids pDR-FLIP43 GPS1 and p16-FLIP43 nlsGPS1 (Rizza et al., 2017) was achieved using QuikChange site-directed mutagenesis kit and Phusion high-fidelity DNA polymerase (NEB) following manufacturer protocol resulting in plasmids pDR-FLIP43 GPS2 (for yeast expression ...
-
bioRxiv - Plant Biology 2023Quote: ... The mutant versions of MUTE constructs were generated in the same way after the site-directed mutagenesis using Q5 Site-directed mutagenesis kit (NEB) and subjected to the Three-Way Gateway reaction after sequence confirmation ...
-
bioRxiv - Zoology 2023Quote: ... followed by the production of stranded cDNA libraries with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Individual barcodes were applied with NEBNext dual adaptors (New England Biolabs ...
-
bioRxiv - Physiology 2023Quote: ... purified and analyzed to quantify 5-methylcytosine levels by applying the DNA Purification Kit (T3010S, Monarch, New England Biolabs, USA) and the 5mC Assay Kit (lot no ...
-
Emergence of RNA-guided transcription factors via domestication of transposon-encoded TnpB nucleasesbioRxiv - Genetics 2023Quote: ChIP-seq Illumina libraries were prepared for immunoprecipitated and input samples using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Following adapter ligation ...
-
bioRxiv - Systems Biology 2023Quote: ... the sequencing library was generated with the NEBNext® Ultra™II Directional RNA Library Prep Kit (New England Biolabs) and paired-end sequencing was processed with the NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR amplification of transposon-genome junctions was performed using the cycling parameters described in the kit for 11 cycles with Q5 Ultra II FS Master Mix (NEB) using primers YL006 (AGCGGCAATTTCACACAGGA ...
-
bioRxiv - Bioengineering 2023Quote: ... The sequencing library was generated using NEBNext® UltraTM II DNA Library Prep Kit (New England Biolabs, MA, United States) and sequenced on an Illumina Nova6000 platform generating 250-bp paired-end reads (Guangdong Magigene Biotechnology Co. ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from 5-10 µl of the cell scrape and prepared for sequencing using the NEBNext Ultra II FS DNA Library Prep Kit (NEB) with the following modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA sequencing libraries were prepared with the NEBNext Ultra II DNA library prep kit according to the manufacturer’s instructions (New England Biolabs, E7645S) and sequenced on the Illumina NextSeq platform with the 75-cycle paired end kit (NextSeq 500/550 High Output Kit).
-
bioRxiv - Bioengineering 2023Quote: ... The IVT reaction product was treated with DNase I to remove DNA template and then purified using the Monarch RNA clean-up kit (NEB). RNA concentration was measured using a NanoDrop (ThermoFisher).
-
bioRxiv - Bioengineering 2023Quote: ... The PCR fragment was gel purified and inserted into plasmids pTRC99a and pKI_IS10 (gift of S. Wenk) using HiFi DNA Assembly Cloning Kit (NEB. pZE21) for Gibson cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... The Ct values of samples were determined by quantitative PCR (qPCR) using a Luna Universal Probe One-Step RT-qPCR Kit (cat. #E3006, New England Biolabs) with LightCycler 480 (Roche Diagnostics ...
-
bioRxiv - Microbiology 2023Quote: ... 3 to 5 ng of RNA from input and corresponding m6A-IPs were used for NGS library production following the protocol NEBNext Ultra II directional RNA library prep kit for Illumina (New England Biolabs), treating samples as rRNA-depleted and fragmented RNAs ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Synthetic Biology 2023Quote: All plasmids used in this study were constructed by Golden Gate cloning using the EMMA cloning platform35 or NEBridge Golden Gate Assembly BsaI-HFv2 and BsmBI-v2 kits (NEB) and are listed in Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared with 2 ng of input or IP DNA using the NEBNext Ultra II DNA Library kit for Illumina (New England Biolabs). The quality of the libraries was assessed using the High Sensitivity DNA kit (Agilent ...
-
bioRxiv - Pathology 2023Quote: ... cDNA libraries for sorted KCs were generated using Next Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). RNA-Seq libraries were sequenced on an Illumina NovaSeq 6000 (40 million reads per sample) ...
-
bioRxiv - Neuroscience 2023Quote: ... which were in vitro transcribed with the mRNA products being capped and polyadenylated by using HiScribe T7 ARCA mRNA Kit (New England Biolabs). mRNA products were column-purified (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Six multiplex amplicons were ligated to Illumina TruSeq adapters using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB), pooled ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500ng of total RNA was used for reverse transcription using ProtoScript II First Strand cDNA Synthesis Kit (New England BioLabs). For quantification ...
-
bioRxiv - Molecular Biology 2023Quote: ... was used as input for PolyA+ directional RNA-seq library preparation using the NEBNext Ultra II Directional RNA-seq Kit (#E7765, NEB) with the PolyA mRNA magnetic isolation module (#E7490 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Short nucleotide sequences were used for transcription according to the HiScribe Quick T7 High Yield RNA Synthesis Kit (NEB, UK) protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries for RNA-Seq were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced on the NextSeq500 (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... The Bh2(Bh1/547-575) chimeric allele was generated using the Q5® Site-Directed Mutagenesis kit (NEB, Ipswich MA) using oligos osd126 and osd127 and p1-BH2 plasmid DNA as template ...
-
bioRxiv - Genetics 2023Quote: Libraries for 12 samples (Table S1) were prepared using the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs, Massachusetts, USA) following the manufacturer’s large insert libraries protocol ...
-
bioRxiv - Genomics 2023Quote: ... DNA extraction from the blood samples was performed using the Monarch HMW DNA Extraction Kit for Cells & Blood (NEB, T3050) following the manufacturer’s protocol (New England Biolabs ...
-
bioRxiv - Genetics 2023Quote: ... The library preparation was done using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). The libraries were sequenced on the NextSeq500 instrument (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... Purified DNA was then constructed into libraries suitable for Illumina sequencing using the NEXT Ultra II library preparation kit (NEB). ChIP libraries were sequenced on the Illumina Hiseq 2500 or Nextseq 550 at the Tufts University Genomics facility.
-
bioRxiv - Microbiology 2023Quote: ... Purified DNA was then made into libraries suitable for Illumina sequencing using the NEXT UltraII library preparation kit (NEB, UK). ChIP libraries were sequenced on the Illumina Hiseq 2500 at the Tufts University Genomics facility.
-
bioRxiv - Microbiology 2023Quote: ... RNA sequencing libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit (New England Biolabs) and the DNA library was prepared using the NEBNext® Microbiome DNA Enrichment Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... and the appropriate crRNA gBlock (IDTDNA; Coralville, IA) was inserted using the NEBuilder HiFi DNA assembly kit (New England Biolabs (NEB); Cambridge ...
-
bioRxiv - Microbiology 2023Quote: ... individual barcodes were incorporated into the dA-tailed DNA using the EXP-NBD104 and EXP-NBD114 native barcoding expansion kit following the ONT protocol with NEB Blunt//TA Ligase Master Mix (New Englands Biolabs). Barcoded DNA samples were then equimolarly pooled ...
-
bioRxiv - Genomics 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Genomics 2023Quote: ... Illumina multiplexing indices were ligated to individual samples using a Phusion polymerase kit (high-fidelity Taq polymerase, New England Biolabs). Final pools were single-end sequenced on four lanes to a length of 75 base pairs (bp ...
-
bioRxiv - Immunology 2023Quote: ... Two μg of RNA served as template for cDNA synthesis using oligo dT and murine leukemia reverse transcriptase as implemented in the OneTaq RT PCR kit (New England Biolabs). A panel of oligonucleotides designed to amplify mouse Ig V genes as described by Wang et al (81 ...
-
bioRxiv - Immunology 2023Quote: RNA of the carriers and non-carriers were constructed into transcriptome libraries using NEBNext Single Cell/Low Input RNA Library Prep Kit (New England BioLabs) and sequenced using NextSeq2000 (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions using equimolar amount of DNA were carried out in presence or absence of 50 nM CTCF using a HiScribe T7 High Yield RNA Synthesis Kit (NEB), adding 100 μM Cy3‐UTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 bp Cy3‐UTP labeled RNA was generated using a PCR‐product containing a T7‐promoter site and the HighScribe T7 high yield RNA synthesis kit (NEB) as well as Cy3‐UTP (Jena Bioscience) ...
-
bioRxiv - Molecular Biology 2023Quote: Sequencing libraries of DNA fragments isolated following CUT&RUN were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs) and the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Microbiology 2023Quote: ... whereas PCR fragments from the agarose gel were purified using the High-Yield PCR Cleanup and Gel Extraction Kit (New England BioLabs). Site-specific mutagenesis of efp was carried out with the Q5® Site-Directed Mutagenesis Kit (New England BioLabs ...
-
Regulation of transcription patterns, poly-ADP-ribose, and RNA-DNA hybrids by the ATM protein kinasebioRxiv - Molecular Biology 2023Quote: ... as well as input samples were used to make sequencing libraries using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) with NEBNext Multiplex dual index primers using 12 amplification cycles and 2 additional AMPure XP clean-up steps at 0.8X ...
-
bioRxiv - Molecular Biology 2023Quote: ... Micro-C libraries were then prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) as described74 and sequenced using an Illumina NovaSeq 6000.