Labshake search
Citations for New England Biolabs :
9651 - 9700 of 10000+ citations for Mouse Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... pENTR221-Scs6 was used as a template to generate Scs6S793F and Scs6H510V via PCR mutagenesis using the Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were generated according to the manufacturer’s instructions: polyA-selected RNA was isolated and libraries were prepared using the NEBNext kit (New England Biolabs, e7500s). Purified libraries were quantified on an Agilent Technologies 2200 TapeStation with a D1000 ScreenTape assay ...
-
bioRxiv - Biochemistry 2022Quote: ... The resulting RNA was used to generate cDNA using the LunaScript®RT SuperMix Kit according to the manufacture’s protocol (New England Biolabs).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 30 ng of methylated DNA was used to generate the NGS (Next-Generation Sequencing) library by using the NEBNext ULTRA DNA Library Prep Kit for Illumina (New England Biolabs) and the NEBNext Multiplex Oligos for Illumina (New England Biolabs ...
-
bioRxiv - Developmental Biology 2023Quote: ... an SP6 promoter was inserted upstream of the transcriptional start using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). All plasmids were confirmed by sequencing.
-
bioRxiv - Biochemistry 2023Quote: ... DNA assembly was performed to join R7-DD and R9-DD to linearised the GFP-cBAK vector using the NEBuilder HiFi DNA assembly kit (NEB).
-
bioRxiv - Bioengineering 2023Quote: ... in vitro transcription (used in experiments in figures otherwise) from the SB100x plasmid using the HiScribe T7 ARCA mRNA (with tailing) Kit (NEB). Following RNA transcription in vitro ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RNA library preparation was performed on total or polysomal RNA using a NEBNext Poly(A) mRNA Magnetic Isolation Module and a NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) according to the manufacturer’s instructions with 1 μg of RNA as a starting point ...
-
bioRxiv - Immunology 2023Quote: ... The following primers were used to amplify the Mpro sequence from cDNA with the Phusion polymerase kit (New England BioLabs). F:AATAAGGTACCAGTGGTTTTAGAAAAATGG ...
-
bioRxiv - Cancer Biology 2023Quote: ... The mutation for generating BN-CD38Mut was introduced to BN-CD38 with Q5 Site-Directed Mutagenesis kit (New England Biolabs). Both were produced transiently in ExpiCHO cells (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Library construction: The RNA sequencing library was constructed using NEBNext® Ultra II RNA Library Prep Kit (New England Biolabs) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-directional sequencing libraries were completed with the “NEBNext Ultra II FS DNA Library Prep Kit for Illumina” (NEB #E7805) and subsequently analyzed on an Illumina NextSeq 550 with v2.5 reagent kits following manufacturer’s protocols.
-
bioRxiv - Cell Biology 2023Quote: ... was introduced into an existing pZDonor-AAVS1-CAG-HA-KLF1-ERT2-PolyA plasmid (28) via site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified DNA was submitted to NGS library preparation using NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, E765) and sequenced with NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... Eluted DNA was used for qPCR or sequencing library preparation with NEBNext Ultra II DNA Library Prep Kit (NEB; E7645) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... beads was fragmented into short fragments using fragmentation buffer and reversly transcribed into cDNA by using NEBNext Ultra RNA Library Prep Kit for Illumina (#7530, New England Biolabs). The purified double-stranded cDNA fragments were end repaired ...
-
bioRxiv - Cell Biology 2022Quote: ... and CUT&RUN samples from two replicate (two independent CRISPRi clones) using NEBNext Ultra II DNA Library Prep Kit for Illumina (E7645, NEB). The manufacture’s protocol was employed with the following changes ...
-
bioRxiv - Biophysics 2023Quote: Illumina sequencing adapters were added by ligation mediated PCR using the NEBNext UltraII DNA Library Prep Kit (New England BioLabs). The libraries were Bioanalyzed on a high sensitivity DNA chip ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ligation product was amplified through 10 reaction cycles to generate a whole genome library (MC library) using NEBNext Ultra II DNA library Prep Kit for Illumina (New England Biolabs) and 750ng MC library was used for exome enrichment ...
-
bioRxiv - Cancer Biology 2023Quote: ChIP-seq libraries were prepared using 2-5 ng of input and ChIP samples and the kit NEBNext Ultra DNA Library Prep for Illumina (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng DNA was subjected to library preparation using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: PT024 RARα cells were treated as described and total RNA were extracted using Monarch Total RNA miniprep kit (NEB #T2010S) according to manufacturer’s protocol.
-
bioRxiv - Genomics 2022Quote: ... continued with end-repair and adaptor ligation by following the NEBNext® Ultra™ II DNA Library Prep Kit (NEB). Ligated DNA was affinity-purified with Dynabeads MyOne Streptavidin C1 beads (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... crushed tissue from the head and legs of a single larvae was used for DNA extraction with Monarch Genomic DNA Purification Kits (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Extracted RNA was prepared for strand specific sequencing by the Biomedical Research Centre Sequencing Core (UBC, Vancouver) using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and polyA selection (NEB). Libraries were sequenced on an Illumina Miseq machine using 300 cycles ...
-
bioRxiv - Genomics 2022Quote: ... The eluted ATAC-Seq library was cloned into AgeI- and SalI-digested pLenti-STARR using a 3:1 molar ratio (insert:backbone) in a total reaction volume of 100 μL using the NEBuilder HIFI DNA Assembly Kit (NEB #E5520S). The reaction was concentrated to a total of 20 μL in a Reaction Cleanup Kit (Qiagen #28206) ...
-
bioRxiv - Genetics 2023Quote: ... Libraries were then generated using 10 ng of DNA with NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). The quality of the libraries was assessed with Agilent 2100 Bioanalyzer Instrument ...
-
bioRxiv - Genomics 2022Quote: ... the resulting products were firstly ligated with barcodes from the Native Barcoding Expansion kits by using NEB Blunt/TA Ligase Master Mix (New England Biolabs) and then with adapter from the Ligation Sequencing Kit (SQK-LSK109 ...
-
bioRxiv - Genomics 2022Quote: ... and then with adapter from the Ligation Sequencing Kit (SQK-LSK109, Oxford Nanopore Technologies) added by using the NEBNext Quick Ligation Module (New England Biolabs). Finally ...
-
bioRxiv - Cell Biology 2023Quote: ... Subsequent steps of RNA-seq were outsourced to Azenta who generated sequencing libraries from polyA-enriched RNA (captured with oligo-dT beads) using the NEBNext Ultra II RNA library prep kit for Illumina (NEB), multiplexed them ...
-
bioRxiv - Developmental Biology 2023Quote: ... Library preparation was either carried out using 0.5 μg of RNA with NEBNext Ultra RNA library Prep Kit for Illumina (New England BioLabs, E7530L) or was performed by Novogene Services ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were constructed from ∼2ng DNA and prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Library quality was assessed by Fragment Analyzer NGS ...
-
bioRxiv - Developmental Biology 2023Quote: ... Library preparation for high-throughput sequencing was performed on 100 ng of rRNA depleted RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing was done with a NextSeq 500/550 High Output Kit v2.5 (150 Cycles) ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA-seq libraries were constructed by NEBNext® Ultra™ II RNA Library Prep Kit for Illumina® (NEB #E7775). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... was used to prepare libraries with the NEBNext Ultra II library preparation kit with unique dual index primers (New England Biolabs). The library quality and quantity were verified by BioAnalyzer DNA 1000 (Agilent ...
-
bioRxiv - Genetics 2023Quote: ... RNA was prepared for sequencing using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760). Sequencing was performed on an Ilumina NovaSeq 6000 instrument equipped with an S4 flow cell generating 150bp paired-end reads ...
-
bioRxiv - Cell Biology 2023Quote: ... The two PCR-amplified DNA blocks were inserted into the linearized AAV-TBG vector by Gibson Assembly using an NEBuilder HiFi DNA assembly kit (NEB) following the manufacturer’s instruction.
-
bioRxiv - Cell Biology 2023Quote: Poly(A)+ RNA was isolated from nuclei and whole cells (see C2C12 cell fractionation above) using the Magnetic mRNA Isolation Kit (New England Biolabs). Two rounds of binding ...
-
bioRxiv - Biochemistry 2023Quote: A luminescence based translation inhibition assay was performed using an in-vitro translation PURExpress® Δ Ribosome Kit from (NEB) The constituents of the kit were incubated with 25 ng pMSR DNA template ...
-
bioRxiv - Biochemistry 2023Quote: ... Parasites were collected by centrifugation (4000 xg, 10 min) and mRNA was extracted using a Quick-RNA Miniprep kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... A 200nt polyA tail was added through PCR and in vitro transcription was carried out using the HiScribe T7 High Yield RNA Synthesis kit (NEB). An m7G cap was introduced by using Vaccinia capping enzyme (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... SPI plasmids were generated by gap-repair cloning directly in yeast or by using the NEBuilder HiFi assembly kit (New England Biolabs) by combining linearised plasmid with gene fragments with homologous ends ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L) following the kit protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′) and the Luna Universal Probe one-step RT-qPCR kit (catalog no. E3006; New England Biolabs). A 20-μL RT-qPCR mixture contained 7 μL of sample ...
-
bioRxiv - Biochemistry 2023Quote: ... Around 1μg of DNA was isolated from each reaction using a Monarch PCR & DNA Cleanup Kit (elution volume of 15 μl, NEB). The DNA was treated with 5 U of Antarctic Phosphatase (NEB #M0289S ...
-
bioRxiv - Genetics 2023Quote: ... The sheared DNA was then used as a template for libraries prepared with a NEBNext Enzymatic Methyl-seq Kit (EM-seq) (New England Biolabs). We note that our previous attempts to develop a hybridization capture protocol using bisulfite-converted DNA were unsuccessful ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then ligating annealed sgRNAs and pre-digested and purified LentiCRISPRv2E vector with Quick Ligation Kit (New England Biolabs, #M2200S). Plasmids were verified to contain expected sgRNA sequences by colony PCR (using LKO.1 5’ and pLentiCRISPR-R1 primers ...
-
bioRxiv - Microbiology 2023Quote: ... 50 ng of total RNA was used as input into the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs). Libraries were prepared following the manufacturer’s protocol for use of the kit with purified mRNA or rRNA-depleted RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Double-stranded DNA was then entered into the end-repair module of RNA Library Prep Kit for Illumina from NEB, and size selected for 500-700 bp inserts using AMPure XP beads ...
-
bioRxiv - Immunology 2023Quote: RNA-seq libraries were generated following the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB #E6420S) protocol for cells ...