Labshake search
Citations for New England Biolabs :
9751 - 9800 of 10000+ citations for Protein Digestion kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Total RNA was extracted from 107 hybridoma cells using the MonarchTM total RNA extraction kit (New England BioLabs, Ipswich, MA, USA) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted from three pooled killing assay spots (as detailed in the previous section) utilizing the Monarch® Genomic DNA Purification Kit (NEB). Quantification of genomic DNA copies was targeted at the kdpAB gene and carried out with the Naica® Crystal Digital PCR System using Sapphire chips (Stilla Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... was used to construct sequencing libraries using the NEBNext Ultra II DNA library preparation kit for Illumina (New England Biolabs; #E7760). Libraries were multiplexed using NEBNext Multiplex Oligos for Illumina (dual index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 µl of the PCR-amplified product was employed for in vitro transcription using the NEB HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, E2040S), with incubation at 37 °C for 18 hours in a thermocycler ...
-
bioRxiv - Microbiology 2023Quote: ... The NGS library preparation was carried out using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB, USA), which performs fragmentation ...
-
bioRxiv - Molecular Biology 2023Quote: ... adaptor ligation and PCR indexing was performed on the denatured amplicons using NEB Next Ultra II DNA library prep kit for Illumina (New England Biolabs, UK). The resulting FASTQ files from RNP treated samples for each of the off target amplicons were analysed for indels through CRISPResso2 webtool [45] by comparing them with untreated samples.
-
bioRxiv - Immunology 2023Quote: ... Base editors were cloned into the IVT template vector using NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs, #E5520S) (Extended Data Table 5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting fragment was then inserted into XhoI and NdeI digested pET21a vector by NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520). As a result ...
-
bioRxiv - Molecular Biology 2023Quote: ... were grown out in LB medium with 50 µg/mL Kanamycin and then pelleted before plasmids were isolated using the Monarch Plasmid Miniprep Kit (NEB, T1010L). Plasmids were sequenced (Sanger ...
-
bioRxiv - Molecular Biology 2023Quote: ... The specimens were then incubated with a 20-fold diluted Quick Ligase in 1x Quick Ligase Reaction Buffer from Quick Ligation Kit (New England Biolabs, M2200), supplemented with an additional 1 mM ATP (TAKARA Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP libraries were generated with input and pulldown DNA using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB E7645L) for sequencing on an Illumina Nextseq with 75-bp read length and single-end.
-
bioRxiv - Molecular Biology 2023Quote: ... of extracted RNA (either from whole-cell lysates or sucrose gradient fractions) was performed using the ProtoScript II First Strand cDNA Synthesis Kit (NEB E6560L) according to the manufacturer instructions with some modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... W165F and S169A) were introduced into human PSEN1 cDNA cloned into the pMSCVpuro vector using Q5 Site-Directed Mutagenesis Kit (NEB BioLabs) according to the standard protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The gene of the mCherry fluorescent protein was inserted into the pHERD20T plasmid according to the manufacturer’s protocol of NEBuilder® HiFi DNA Assembly kit (New England Biolabs, UK). The resulting plasmid was named pHERDmCh ...
-
bioRxiv - Cancer Biology 2023Quote: ... the tissue samples were stained using Vizgen’s Cell Boundary Kit (Vizgen, 10400009) and blocked in blocking solution (Vizgen, 20300012) supplemented with a 1:20 dilution of Rnase inhibitor (NEB, M0314L) for one hour ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA synthesis and qRT-PCR were performed in a one-pot reaction using Luna® Universal One-Step RT-qPCR Kit (NEB). A QuantStudio Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... the mCherry-SopF coding sequence was cloned into the pPB Piggybac plasmid (Vectorbuilder) using the NEB HIFI DNA Assembly Kit (NEB, E2621L).
-
bioRxiv - Cell Biology 2023Quote: ... RNA-Seq libraries were prepared with NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext® UltraTMII Directional RNA Library Prep Kit (New England Biolabs). Libraries were sequenced using the NovaSeq 6000 system (Illumina ...
-
Multi-omics analysis reveals signatures of selection and loci associated with complex traits in pigsbioRxiv - Genomics 2023Quote: ... sequencing libraries were generated using the rRNA-depleted RNA by NEBNext UltraTM Directional RNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2023Quote: ... The remaining RNA was used to produce the sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc.) with AMPure XP (Beckman Coulter Life Sciences ...
-
bioRxiv - Immunology 2023Quote: ... Ribosomal RNA from 1000 ng total extracted RNA was depleted using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat; New England Biolabs Inc.). The remaining RNA was used to produce the sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 3 - 10 × 106 EB-derived CD71+ were processed per biological replicate and libraries of sufficient quality were indexed using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs: E7645) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB, E7760L) by following manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... adapter ligation and PCR amplification (9 cycles) was performed using NEBNext Ultra II directional RNA library prep kit for Illumina protocol (NEB, E7760) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... oligonucleotides corresponding to each CTCF element were cloned into the pROSA-TV2 vector (created by Prof. Benjamin Davies group) between the pair of BsaI sites using the Golden Gate Assembly Kit (NEB, E1601) and this generates the HDR donor template containing the inserted CTCF element ...
-
bioRxiv - Genomics 2023Quote: MChIP-C NGS libraries were prepared from immunoprecipitated DNA with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2023Quote: ... All the libraries were prepared together using the NEBNext® Ultra™ II RNA Library Prep Kit (New England BioLabs Inc.) as per the manufacturer’s protocol within one sitting ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from starter cultures of the three original ancestor isolates and 10 trimethoprim-resistant derivatives using New England Biolabs Monarch Genomic DNA Extraction Kit (New England Biolabs, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and used to generate sequencing libraries using the NEBNext Ultra II FS Library Prep kit (New England Biolabs, Ipswich, MA, USA), followed by sequencing on the Illumina MiSeq platform to generate 250 bp paired end reads ...
-
bioRxiv - Genomics 2023Quote: ... and strand-specific sequencing libraries were made using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, E7760S) with eight cycles of amplification ...
-
bioRxiv - Developmental Biology 2023Quote: Libraries for RNA sequencing were generated using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB #E6420) in conjunction with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Molecular Biology 2023Quote: ... the same amount of input RNA was loaded for library preparation using the NEBNext Multiplex Small RNA library preparation kit (New England Biolabs, USA). Libraries were size-selected for fragments 15-50 bp by gel electrophoresis ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 ng of total RNA from each sample was used for preparing the libraries with the NEBNext Ultra II Directional RNA Library Prep kit (New England Biolabs, #E7760), using the rRNA depletion module ...
-
bioRxiv - Plant Biology 2024Quote: cDNA libraries with different insert sizes were constructed using the NEB Next Ultra TM Directional RNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations and were assessed on an Agilent Bioanalyzer 2100 system ...
-
bioRxiv - Immunology 2024Quote: Sequencing: Poly A-enriched libraries were made using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, cat. E7770) and sequenced on a NovaSeq SP with PE150 read length.
-
bioRxiv - Genomics 2023Quote: ... and strand-specific sequencing libraries were made using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, E7760S) with 8 cycles of amplification ...
-
bioRxiv - Genomics 2023Quote: 50μl of size selected DNA was used as the start material for library generation using NEBNext Ultra II DNA library preparation kit for Illumina (NEB E7645S). The end preparation (end repair and A tailing ...
-
bioRxiv - Microbiology 2023Quote: ... and the appropriate crRNA gBlock (IDTDNA; Coralville, IA) was inserted using the NEBuilder HiFi DNA assembly kit (New England Biolabs (NEB); Cambridge ...
-
bioRxiv - Microbiology 2023Quote: ... Region of Cori and ter were quantitatively amplified using the Sybr green-based Luna Universal One-step RT-qPCR kit (New England Biolabs Inc.), without the reverse transcriptase enzyme ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA libraries were prepared by reverse transcribed total RNA using a ProtoScript® II First Strand cDNA Synthesis Kit (NEB, #E6560) with d(T)23 VN oligo and sent to Novogene for sequencing using Illumina Novaseq 6000 (PE 150bp with 6Gb read depth coverage).
-
bioRxiv - Microbiology 2024Quote: ... Input control and HT-enriched samples were prepared for Illumina sequencing using NEBNext Ultra II Library Prep Kit for Illumina (NEB; E7645S) following manufacturer’s protocol and sequenced on Illumina NovaSeq 6000 2×150 with the UW-Madison Biotechnology Center at ∼10 million reads per sample.
-
bioRxiv - Genetics 2024Quote: Total RNA from mouse glomeruli was sequenced on a HiSeq 4000 following standard workflow using NEBNext Ultra II RNA Library Preparation kit (New Englab Biolabs, MA)(Illumina ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... Library preparation was performed by EMBL Genomics Core Facility using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L), in combination with the NEBNext Poly(A ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... RNA was then extracted by adding an equal volume of RNA lysis buffer and proceeding with Monarch Total RNA Miniprep Kit (NEB #T2010S) extraction ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Barcoded mutant variants were then cloned into the cut vector using the NEBuilder HiFi DNA Assembly Kit (NEB, Cat. No. E2621) with a 1:3 insert to vector molar ratio in a 1 hour reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... pMT-mCherry-Rlip and pMT-Rlip-mCherry were cloned from pMT-Rlip-HA using NEB HiFi Assembly kit (NEB cat#E5520) to exclude the retained intron and incorporate the mCherry open reading frame into pMT-V5-His vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... The molecular barcoded ChIP-seq library was prepared with all ChIPed-DNA obtained using the NEBNext UltraII DNA library Prep kit (NEB, E7645S). The quality of the libraries was assessed on a Bioanalyzer (Agilent) ...
-
bioRxiv - Developmental Biology 2024Quote: ... the corresponding sgRNA was designed online (https://benchling.com) and was synthesized by using the HiScribe™ T7 RNA Synthesis Kit (NEB, E2050). The purified RNA and Cas9 protein (Cat1081058 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 500 ng total RNA was used as template with the Luna Universal One-step RT-qPCR kit (New England Biolabs, E3005L). For each condition 3 biological replicates with two technical replicate RT-qPCR reactions were run on a CFX96 Connect Real-Time System (BioRad) ...