Labshake search
Citations for New England Biolabs :
9551 - 9600 of 10000+ citations for Protein Digestion kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... was added to 500 ng total RNA then the rRNA was depleted with the NEBNext rRNA depletion kit V2 (NEB, E7400L) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were barcoded using Illumina i5 and i7 adaptors from NEBNext® Multiplex Oligos for Illumina (Dual Index Primers Set 1) kit (New England Biolabs) and sequenced using a 150-cycle NextSeq 500/550 High Output Kit v2.5 with 75 forward and 75 reverse reads ...
-
bioRxiv - Neuroscience 2024Quote: ... C terminal and αPKC binding region) or PICK1 (BAR domain) were made with NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520S). Mutations of PICK1 (KD-AA and 5K-E ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were created using 1000ng of total RNA with the NEBNext Ultra 2 Directional RNA Library Kit following the Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) and sequenced on an Illumina Hi-Seq 2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was prepared with 0.1-1 µg of total RNA using the Protoscript First Strand cDNA Synthesis kit (New England Biolabs; Catalogue #E6560L) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted from zebra finch and chicken embryos using QIAgen RNeasy kit and transcribed into cDNA using LunaScript RT (NEB #E3010). PCR was performed using chicken or zebra finch cDNA and gene specific primers (Supplemental table 33) ...
-
bioRxiv - Cell Biology 2024Quote: ... The WT PACT expression vector was used as template for constructing p38 mutant PACT clone by using Q5 site-directed mutagenesis kit (New England Biolabs, E0554S). Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Qualified RNA samples were subjected to sequencing library construction using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, E7775). Paired-end (2 × 150 bp ...
-
bioRxiv - Genomics 2023Quote: ... DNA libraries for Next Generation Sequencing were prepared with NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs E7775) and NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA Set 1 ...
-
bioRxiv - Genomics 2023Quote: ... was extracted from hTERT RPE-1 dry cell pellets using the Monarch HMW DNA extraction kit for cells & blood (New England Biolabs, NEB T3050L) and for tissue (NEB T3060L) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... four sequencing libraries were generated by NEBNext® Ultra ™II DNA Library Prep Kit for Illumina ® (NEB, Ipswich, MA). Sizes and concentrations of the sequencing libraries were again verified by the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Genomics 2024Quote: ... amplification of the target USH2A region using gDNA of a human heterozygous USH2A:c.7595-2144A/G patient and subsequent cloning into the pSPL3 backbone vector by NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs). The intronic sequence encompassing the USH2A:c.7595-2144 location was introduced in the recipient pSPL3 exon trapping vector ...
-
bioRxiv - Genomics 2024Quote: ... The digest product was run on a 1% agarose gel and the band was excised and purified using a Monarch DNA Gel Extraction Kit (NEB #T1020) following the manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2024Quote: ... libraries were prepared in quadruplicate from 1ug DNA using the NEBNext® Ultra II ligation kit (New England Biolabs, Ipswitch, MA) according to the manufacturer’s protocols ...
-
bioRxiv - Genomics 2024Quote: ... after which the RNA probes were purified using the Monarch® RNA Cleanup kit (50 µg) (New England Biolabs, Ipswitch, MA). Finally ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A clean-up step was performed using Qiagen MinElute PCR purification kit and PCR-amplified using NEBNext Ultra Q5 DNA polymerase master mix (New England Biolabs®) with forward primer (5’-TAGAGCATGCACC GGCAAGCAGAAGACGGCATACGAGAT[N10]ATGTCTCGTGGGCTCGGAGATGT-3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA Magnetic Isolation Module (E7490L) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760L, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Developmental Biology 2024Quote: ... and PCR amplification to prepare cDNA libraries using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, USA). Library preparation and next-generation sequencing were outsourced to Rhelixa Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... was synthesized from 300 ng to 1 μg of total RNA using a NEB ProtoScript II first strand cDNA synthesis kit (NEB, E6560). For RNA-sequencing ...
-
bioRxiv - Genomics 2024Quote: ... IVT reactions were set up in 30 μl total volume with the HiScribe T7 High Yield RNA Synthesis Kit (NEB E2040S) with 2 μl of each NTP ...
-
bioRxiv - Genomics 2024Quote: ... 2 µg genomic DNA was used to construct a sequencing library following the manufacturer’s instructions using NEBNext Ultra DNA Library Prep Kit (NEB Inc., America). Paired-end sequencing libraries with an insert size of approximately 400 bp were sequenced on an Illumina HiSeq 4000 sequencer ...
-
bioRxiv - Cell Biology 2024Quote: ... The samples were then centrifuged at 13000 x g for 1 minute and the supernatant was once more purified using the Monarch® PCR & DNA Cleanup Kit (New England BioLabs). We expect the “crush and soak” method to improve signal strength if low labeling densities are used during extension.
-
bioRxiv - Microbiology 2024Quote: ... We then assembled the digested backbone with the mutagenized GPC inserts with NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621) at a 1:2 vector to insert ratio for a 1 hr reaction ...
-
bioRxiv - Immunology 2024Quote: ... The sequences containing T7 promoter and sgRNA were PCR-amplified and used as templates to produce sgRNAs through in vitro transcription using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, E2040S). All sgRNAs were purified by lithium chloride precipitation and stored at −80°C.
-
bioRxiv - Immunology 2024Quote: ... Sample preparation was performed according to the protocol “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” (NEB #E7760S/L). Briefly ...
-
bioRxiv - Microbiology 2024Quote: Approximately 40mg of feces were used for RNA extraction using the Monarch® Total RNA Miniprep Kit (New England Biolabs, NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: Approximately 40mg of feces were used for RNA extraction using the Monarch® Total RNA Miniprep Kit (New England Biolabs, NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... A fragment containing the CRISPR array plus the extra BsrG1 restriction site was cut from the synthesized pUC19 by digestion with DraI and BstZ17I enzymes and cloned into the BsaI-linearized pSTU-1 plasmid using the NEBuilder HiFi cloning kit (New England Biolabs, UK). The plasmid sequence was confirmed by sequencing (Eurofins Genomics ...
-
bioRxiv - Immunology 2024Quote: ... or a low input method using NEB Next® Ultra RNA Library Prep Kit for Illumina® (NEB, Cat. No. 7530). First-strand cDNA synthesis and tailing by reverse transcription were performed using SMART (Switching Mechanism at 5’ End of RNA Template ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (New England Biolabs) and each individual library was barcoded using the NEBNext® Multiplex Oligos for Illumina® kit (New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... the point mutations to synthesize AID-C12*-dCas9-BE4max and AID-C12*-n’Cas9-BE4max were generated using the Q5 Site-Directed Mutagenesis Kit (NEB, Cat #E0554S).
-
bioRxiv - Cancer Biology 2023Quote: ... These products were then purified by separation on a 1.0% agarose gel at 100 volts constant for 1 hour and were then purified via the Monarch DNA gel extraction kit (NEB, #T1020L). Purified products were quantified with qubit high sensitivity dsDNA kit (Invitrogen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Positive colonies were incubated overnight at 37°C and plasmids were isolated using the Monarch Plasmid Miniprep Kit (New England Biolabs, T1010L). For all assembled plasmids the sequence was confirmed by Sanger sequencing ...
-
bioRxiv - Genetics 2023Quote: ... Post rRNA removal samples were prepared for either Illumina or Singular Sequencing using NEBNext Ultra II RNA Library Prep Kit for Illumina with Beads (NEB#E7775). Singular specific primers for the libraries sequencing on Singular which had the S1/S2 handles instead of Illumina’s p7/p5 handles.
-
bioRxiv - Genetics 2023Quote: ... were carried out with 3 nM of each DNA fragment from the master mix and 2 µL of the NEBridge Golden Gate Assembly Kit (BsaI-HFv2) (NEB E1601S) in 1X T4 DNA ligase Reaction Buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... were combined using a the NEBuilder Hi-Fi DNA assembly kit according to the manufacturer’s instructions (E5520, New England BioLabs, Waltham, MA). The resulting product was transformed into then transformed into competent cells (C2987 ...
-
bioRxiv - Cell Biology 2023Quote: ... These fragments were combined using a the NEBuilder Hi-Fi DNA assembly kit according to the manufacture’s instructions (E5520, New England BioLabs, Waltham, MA). The resulting product was transformed into then transformed into competent cells (C2987 ...
-
bioRxiv - Cell Biology 2023Quote: Capped mRNAs with poly-A tail were synthesized from linearized pGEMHE plasmids using the HiScribe™ T7 ARCA mRNA Kit (NEB). The mRNA was purified by Monarch RNA Cleanup Kit (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... The C-KSR-GS construct replacing the vector-based linker (LELKLRILQS) by a glycine-serine rich linker (GGSSGGGGA) was generated by site directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, NEB, USA) of the C-KSR-EGFP plasmid ...
-
bioRxiv - Immunology 2023Quote: Immunoglobulin libraries were generated from 1 μg of RNA using the NEBNext Immune Sequencing Kit (New England Biolabs, Ipswich, Massachusetts, USA) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and day 14 post-transfection and genomic DNA (gDNA) was extracted using Monarch Genomic DNA Purification Kit (New England Biolabs, T3010L). Target regions were amplified by PCR to add barcodes for multiplexing ...
-
bioRxiv - Developmental Biology 2023Quote: ... was synthesized from 300 ng to 1 μg of total RNA using a NEB ProtoScript II first strand cDNA synthesis kit (NEB, E6560). The sequences of the primers used for RT-PCR are listed in Table S2.
-
bioRxiv - Genetics 2023Quote: ... 1ug of RNA was used to synthesize cDNA using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB Cat #E6560L). 50ng of cDNA was used to perform qPCR with PowerUp SYBR Green Master Mix (ThermoFisher Cat # A25741) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then <5 ng ChIP sample DNA or <20 ng input DNA was used for sequencing libraries using the NEB Next Ultra II DNA Library Prep Kit for Illumina (New England BioLabs, E7645). In Step 1.3 (End Prep) ...
-
bioRxiv - Genomics 2023Quote: ... was end repaired and adapters were ligated to it following the procedure of the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645S), purified using AMPure XP beads and eluted in 50 μL of H2O ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... USA) to enable miniaturized library preparation with the NEBNext Ultra II RNA Library Prep Kit (New England Biolabs, Beverly, MA, USA). Library preparation was performed per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: RNA extracts from WWI were prepared for RNA sequencing using the NEB Ultra II RNA Sequencing kit (New England Biolabs, E7770S), following manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2023Quote: Mouse tail (1cm) was used to extract the genomic DNA (gDNA) using NEB Monarch® Genomic DNA Purification Kit (NEB T3010L). DNA concentration was measured on Qubit dsDNA BR assay kit (cat ...
-
bioRxiv - Genomics 2023Quote: ... and then prepared into a whole-genome shotgun library using the NEB Ultra Library Prep kit (New England Biolabs; Ipswich, MA). Instead of the standard Illumina library prep adaptor ...
-
bioRxiv - Microbiology 2023Quote: RNA extracts from WWI samples were reverse transcribed to synthesize cDNA using the LunaScript SuperMix RT kit (New England Biolabs, E3010L); 10 µL of each RNA extract was used in a total reaction volume of 20 µL ...