Labshake search
Citations for New England Biolabs :
9351 - 9400 of 10000+ citations for Protein Digestion kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... were used as template of the in vitro transcription (HiScribe™ T7 Quick High Yield RNA Synthesis Kit; #E2050S, New England Biolabs), performed at 37°C for 16h ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA libraries were prepared from total RNA samples with an RIN ≥ 8.0 using the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina® (New England BioLabs). An Illumina NovaSeq 6000 machine with an S4 flow cell was used to generate pairwise 100 bp reads (performed by the Yale Center for Genome Analysis).
-
bioRxiv - Genetics 2020Quote: ... All DNA fragments were assembled using the NEBuilder® HiFi DNA Assembly Cloning Kit (Catalog number: E5520S, New England Biolabs, USA) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... An Illumina DNA library was prepared with the NEBNext® Ultra™ II FS DNA Library Prep Kit (NEB, Ipswich, USA) and multiplex barcoded with NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 2 ...
-
bioRxiv - Genetics 2020Quote: ... Purified PCR products were used as templates for in vitro transcription using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, New England Biolabs). Cas9 mRNA and gRNAs were then purified using RNAClean XP(Beckman Coulter ...
-
bioRxiv - Genetics 2020Quote: ... The PCR products were purifified using the FastPure Gel DNA Extraction Mini Kit (Vazyme, DC301-01, Nanjing, China) and then digested by BamHI and HindIII restriction enzymes (New England Biolabs, Inc.). C-terminal EGFP-tagged mouse full-length Pabpn1l was cloned into pcDNA3.1(+ ...
-
bioRxiv - Cell Biology 2021Quote: ... containing TauRD-I260C for fluorescent labeling were constructed by mutagenesis of the pHUE-TauRD (P301L/V337M) plasmid using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Cell Biology 2021Quote: ... RNA-seq libraries were generated with 300 ng of total RNA using NEB Next Ultra II RNA Library prep kit (NEB, E7770) according to the vendor’s protocol ...
-
bioRxiv - Genomics 2021Quote: We generated three replicates of +/- doxycycline-treated RNA-sequencing libraries with the NEBNext Ultra II Directional RNA Library Prep Kit (NEB #E7765S). We quantified and assessed the quality of the libraries with an Agilent 2200 Tapestation instrument ...
-
bioRxiv - Microbiology 2021Quote: ... OtownIsak and SummerBoyErik were prepared using NEBNext® Ultra II FS library prep kit for Illumina (New England Biolabs, Ipswich, USA), while the sequencing library for Hovsa was prepared with Nextera® XT DNA Kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... The D614G Spike was generated by introducing the corresponding mutation in the Wuhan reference strain using Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Physiology 2020Quote: ... Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554). Adeno-associated viruses (AAV ...
-
bioRxiv - Microbiology 2019Quote: ... DNA fragments with the size of 350-700 bp were separated on an agarose gel during electrophoresis and purified for input into the NEBNext Ultra DNA Library Prep Kit for Illumina® (New England BioLabs). Prepared libraries were quantified using KAPA Library Quantification Kits for Illumina® platforms (KAPA Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... where a sequencing library was prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs, USA). This library was sequenced on an Illumina platform with 150 bp paired-end chemistry.
-
bioRxiv - Cell Biology 2020Quote: ... Libraries for next generation sequencing were constructed with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, E7760) and sequenced on a HiSeq2500 Sequencer ...
-
bioRxiv - Cell Biology 2020Quote: Three point mutations in the predicted miR-145 seed binding site in DUSP6 were introduced in pGEM-T-DUSP6 3’UTR using a Phusion® site-directed mutagenesis kit (NEB) and the mutagenic primers ...
-
bioRxiv - Cell Biology 2020Quote: ... 200 ng/μL was used for subsequent reverse transcription assay with Luna® Universal One Step RT-qPCR kit (E3005, New England Biolabs) according manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: Yeast Coq7 and Coq9 point mutants were constructed as described in the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) and were confirmed via Sanger sequencing ...
-
bioRxiv - Biochemistry 2021Quote: ... Transcription templates were amplified from the plasmids by PCR and and transcribed in vitro with the HiScribe T7 High Yield RNA synthesis kit (New England Biolabs Inc.). To obtain sufficient amounts of mRNA ...
-
bioRxiv - Biochemistry 2021Quote: Population genomic DNA was extracted from frozen cell pellets using the Monarch Genomic DNA Purification Kit (New England Biolabs, Beverly, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNA was isolated from parental and KDM6B KO2 HeLa cells and subjected to bisulfite modification by EpiMark® Bisulfite Conversion Kit according to the manufacturer’s instructions (New England Biolabs, E3318S). The converted DNA was eluted in DNase/RNase-free water and examined by PCR using SYBR Green PCR Master Mix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... and libraries were generated for next-generation sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, #E7760L) according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2021Quote: The predicted late domain motifs encoded in TgGRA14 C-terminus were mutated in the pGagGRA14_Venus by site-directed mutagenesis (Q5 Site-Directed mutagenesis kit NEB, Cat#E0554S). Primers encoding mutation alanine substitutions for PTAP or YPXL were used to generate pGagGRA14TSG101-_Venus and pGagGRA14ALIX-_Venus (P11 + P12 and P13 + P14) ...
-
bioRxiv - Developmental Biology 2021Quote: ... IRES-Puro and an FRT-flanked PGK-hygromycin selection cassette to generate the targeting vector using the NEBuilder High-Fidelity DNA Assembly Cloning Kit (NEB, E5520). Twenty-one bp downstream of the start codon ...
-
bioRxiv - Synthetic Biology 2021Quote: Expression units were assembled from cloned level 0 parts into level 1 destination vectors provided by the MoClo kit using 40fmol of each vector and 20 U of BsaI-HFv2 (NEB, R3733L) with remaining conditions as described above ...
-
bioRxiv - Immunology 2021Quote: ... Twenty ng of purified PCR product was used as input for library construction using the NEBNext Ultra II FS DNA Library Prep Kit (NEB, E6177S) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription reactions were performed with 6 μl of purified RNA and random primers using the NEB ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and all mutant forms of NMA1 were created using a Q5 site-directed mutagenesis kit (New England Biolabs, Ispwich, MA, USA).
-
bioRxiv - Neuroscience 2021Quote: ... We amplified and prepared these libraries for sequencing with the NEB Next Ultra RNA Library Prep Kit (New England Biolabs E7530S) and NEBNext multiplex oligos for Illumina (NEB E7335S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Genomics 2021Quote: ... and libraries were generated from 250 ng starting material with NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs E7765). Libraries were sequenced on an Illumina NextSeq 500 with 150 bp paired-end reads.
-
bioRxiv - Genomics 2022Quote: ... 100 ng of the resulting 5C product was prepared for sequencing on the Illumina NextSeq 500 using the NEBNext Ultra DNA Library Prep Kit (NEB E7370) following the manufacturer’s instructions with the following parameter selections ...
-
bioRxiv - Pathology 2021Quote: ... in an Applied Biosystems StepOnePlus Real-Time PCR System (USA) and tracked with a DNA-intercalant green fluorophore provided with the WarmStart LAMP Kit (NEB, USA). The RT-LAMP amplification was set to 45 minutes for experiments illustrated in Figures 2 ...
-
bioRxiv - Biophysics 2021Quote: ... RNA aliquots were used for library preparation using NEBNext Multiplex Small RNA library preparation kit (New England Biolabs, Ipswich, MA, USA). The PCR amplified cDNA construct (from 140–160 bp ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 1μg of total RNA from each sample was reverse transcribed into cDNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... A D10A mutation was introduced by site-directed mutagenesis of the original Puro-Cas9 donor with the Q5 mutagenesis kit (New England Biolabs, E0554S) to generate the Cas9n ...
-
bioRxiv - Developmental Biology 2021Quote: ... The gRNA templates were amplified by PCR with scaffold reverse primer then were transcribed with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) [22] ...
-
bioRxiv - Biophysics 2020Quote: ... Single point mutations in KIF1A were generated by the NEB Q5® site-directed mutagenesis kit (New England Biolabs Inc. #E0554S) and confirmed by sequencing.
-
bioRxiv - Cell Biology 2020Quote: ... A STOP codon was introduced at the end of the coding sequence of FLAG-UBE2K using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs GmbH) according to the manufacturer’s instructions and the primers TGATTGGACCCAGCTTTCTTG and GTTACTCAGAAGCAATTCTG.
-
bioRxiv - Cell Biology 2020Quote: ... Two missense point mutations present in the initial plasmid (c1411t and c2671t) were corrected using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554S) according to manufacturer protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Antisense probes were converted to RNA from this template using the HiScribe™ SP6 RNA synthesis Kit (New England BioLabs, E2040S). Sense probes were converted to RNA from this template using the HiScribe™ T7 RNA synthesis Kit (New England BioLabs ...
-
bioRxiv - Cell Biology 2020Quote: ... Sense probes were converted to RNA from this template using the HiScribe™ T7 RNA synthesis Kit (New England BioLabs, E2070S). In each RNA synthesis reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... Mutant constructs (fam83faF275A, fam83faF279A and fam83faF275/279A) were generated by site-directed mutagenesis using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... and 1 μg of purified PCR product was used as template for in vitro transcription using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, E2040S) as described by the manufacturer.
-
bioRxiv - Genomics 2020Quote: ... Novogene prepared a PCR-free Illumina sequencing library using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, USA), with the manufacturers protocol modified to give a 500 bp – 1 kb insert size ...
-
bioRxiv - Microbiology 2021Quote: ... The seven PCR products were assembled into the pCC1-F567-mNG plasmid that were pre-linearized with NheI and XhoI by using the NEBuilder® HiFi DNA Assembly kit (NEB) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2020Quote: ... RNA sequencing libraries were prepared from 500 ng of each total-RNA sample using the NEBNEXT Ultra II Directional RNA Library Prep kit with Poly-A mRNA magnetic isolation (NEB #E7490) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... or more amino acid substitutions in SecPH with Q5 PCR methodology (Q5®Site-Directed Mutagenesis Kit, New England Biolabs, E0554) or PCR site-directed mutagenesis strategy ...
-
bioRxiv - Molecular Biology 2021Quote: ... For the library preparation the NEBNext® Ultra™ II DNA Library Prep Kit from NEB (New England Biolabs, Ipswich, MA) was used ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were assembled from fragments (linearized vector, PCR products, and/or synthetic DNA) using the NEBuilder Hifi DNA assembly kit (New England Biolabs (NEB) E2621) ...