Labshake search
Citations for New England Biolabs :
901 - 950 of 2329 citations for Human PRPF31 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Derivatives of this plasmid were made using a Q5 site-directed mutagenesis kit (NEB). Single copy deaD-lacZ fusions were made by recombining the plasmid-borne fusions with modified λ phage ...
-
bioRxiv - Genetics 2020Quote: Repair template plasmids were assembled from overlapping fragments using the NEBuilder HiFi Kit (NEB) per manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCS2-Rab11S25N-mCherry plasmid was generated using Q5 Site-Directed Mutagenesis Kit (NEB) with PCS2-Rab11-mCherry plasmid and Rab11S25N-mCherry-Fwd (TGTGGGGAAGaatAACCTGCTGT ...
-
bioRxiv - Cell Biology 2022Quote: ... pRS306-GFP-linker-CDC42 plasmid was linearized with PshAI (Cat#R0593S, New England Biolabs) and co-transformed with a PCR product containing the desired K-to-R changes into an uracil auxotrophic strain (PC538) ...
-
bioRxiv - Immunology 2022Quote: HIV envelope plasmids were transformed and amplified in NEB-stable competent cells (NEB, C3040H). Pseudoviruses were produced by co-transfection of plasmids encoding various HIV-1 Envs together with NL4-3 ΔEnv or Q23-ΔEnv (1:3 ratio ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and plasmids were constructed by using Q5 High-Fidelity DNA polymerase (New England Biolabs) to produce amplicons and ligating amplicons to PCR amplified vectors using Golden Gate DNA assembly.59 The broad range RSF1010 backbone was used for all plasmids and was given generously by Shyam Bhakta.60 All plasmid sequences were verified with Sanger sequencing.
-
bioRxiv - Neuroscience 2022Quote: ... The plasmids were digested with appropriate restriction enzymes (New England BioLabs, Ipswich, MA, USA) under optimal conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and inserted into the pGLuc Mini-TK 2 Gaussia luciferase enhancer reporter plasmid (NEB) via KpnI/SacI restriction sites ...
-
bioRxiv - Microbiology 2022Quote: ... using a pCAGGS plasmid digested with EcoRV-HF and HindIII-HF (New England Biolabs) as backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmids were constructed using standard restriction enzyme cloning or Gibson assembly (New England BioLabs). All plasmids used in this work are described in Supplementary file 2.
-
bioRxiv - Microbiology 2022Quote: ... coli host strain using the Monarch® Plasmid Miniprep Kit (NEB, Ipswich, MA, USA). The extracted plasmid was linearized with restriction enzyme BamHI (Promega ...
-
bioRxiv - Genomics 2022Quote: ... pDR274 transcription plasmids containing the gRNA sequences were linearized with DraI (NEB; Ipswich, MA) and amplified using Accustart Taq DNA Polymerase HiFi (Quanta Biosciences ...
-
bioRxiv - Genetics 2023Quote: ... Plasmid assembly was conducted using NEBuilder HiFi DNA Assembly cloning kit (NEB, cat # E5520S) and transformed to DH5α-competent cells ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid was transformed into BL21 (DE3) competent cells following the manufacturer’s protocol (NEB), a single colony was inoculated into 10 mL LB ampicillin (10 mg/ml ...
-
bioRxiv - Immunology 2023Quote: ... the scFv insert from isolated plasmids was amplified by PCR using Q5 polymerase (NEB). DNA samples were prepped and run using the Illumina MiSeq v3 reagent kit following manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... coli PURExpress system were generated from the T7 PURExpress plasmid (New England Biolabs, USA). pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A gene replacement cassette was assembled in plasmid pSS187 by NEBuilder HiFi assembly (NEB) and amplified from the plasmid as a linear fragment by PCR ...
-
bioRxiv - Systems Biology 2023Quote: ... Plasmids were constructed with Q5 High-fidelity DNA polymerase (New England BioLabs Inc., NEB) and the Gibson Assembly Master Mix (NEB) ...
-
bioRxiv - Systems Biology 2023Quote: ... Plasmids were constructed with Q5 High-fidelity DNA polymerase (New England BioLabs Inc., NEB) and the Gibson Assembly Master Mix (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All PCR amplifications for plasmid construction were performed using Q5 High-Fidelity Polymerase (NEB). All plasmids were sequence verified through Sanger sequencing ...
-
bioRxiv - Bioengineering 2023Quote: Plasmids were generated by standard molecular biology techniques including HiFi assembly (New England BioLabs). All plasmids were prepared for microinjection using the NucleoBond Xtra Midiprep kit EF (Machery-Nagel ...
-
bioRxiv - Microbiology 2023Quote: ... Active site mutant plasmids were assembled using the Q5 Site-Directed Mutagenesis Kit (NEB). Site-directed mutagenesis reactions were transformed into chemically competent NEB5α or DH5α λpir cells and candidate transformants were selected using kanamycin ...
-
bioRxiv - Microbiology 2023Quote: ... LucEV-A71 assay: The plasmid was linearised using Mlu1 restriction enzyme (NEB, Cat # R3198S), and purified using Phenol:Chloroform:Isoamyl Alcohol (PCI 24:25:1 ...
-
bioRxiv - Microbiology 2023Quote: ... and ligated into the pET17b plasmid randomly using the Gibson Assembly Master Mix (NEB). The transformation was performed in the same manner as the above.
-
bioRxiv - Microbiology 2023Quote: ... Recombinant plasmids were recovered by transformation of Escherichia coli NEB5α F’IQ (New England Biolabs) and selected on LB agar supplemented with 50 μg/ml Kanamycin ...
-
bioRxiv - Biochemistry 2023Quote: ... The modified pUC19 target DNA plasmid was linearized by HindIII-HF (New England Biolabs) in advance ...
-
bioRxiv - Biophysics 2023Quote: ... Halo-CD36 plasmid was linearized using restriction enzymes EcoRI and BglII (New England Biolabs) to release the CD36 fragment ...
-
bioRxiv - Immunology 2023Quote: ... the Gemini 1.0 plasmid underwent in vitro transcription using T7 RNA polymerase (NEB, M0251L), followed by in vitro 5’ capping and 3’ polyadenylation ...
-
bioRxiv - Cancer Biology 2023Quote: ... pcDNA3.1 plasmids cloned with the desired inserts were linearized with PvuI (New England Biolabs) before transfection with 293fectin (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... The methylated template plasmids remaining in the PCR products were digested by DpnI (NEB), and after transformation to E ...
-
bioRxiv - Developmental Biology 2023Quote: ... The resulting ROSA-Kaleidoscope plasmid was also treated with a Cre recombinase (M0298, NEB) for 30 min at 37°C to remove the transcriptional stop cassette to test the fusion proteins in culture.
-
bioRxiv - Biochemistry 2023Quote: ... were transformed with Lpg2248 (LotA) plasmids and T7 express Escherichia coli competent cells (NEB) were transformed with Lpg1621 (LotB ...
-
bioRxiv - Biochemistry 2023Quote: ... The His-MBP-Cas12a plasmid was transformed into BL21(DE3) cells (New England Biolabs). A single colony was used to inoculate LB media supplemented with 50μg/ml Kanamycin for an overnight culture grown at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmids were assembled using the NEBuilder HiFi DNA Assembly kit (New England BioLabs). The different truncated or point mutants derived from these plasmids were generated by PCR amplification using primers (Supplementary Table 6 ...
-
bioRxiv - Systems Biology 2023Quote: ... The final plasmids were assembled using NEB T4 Ligase (New England Biolabs, Ipswitch, MA) according to the manufacturers protocol with ca ...
-
bioRxiv - Cell Biology 2023Quote: ... To amplify the SNAP tag sequence out of the pSNAPf plasmid (New England Biolabs), the following primers were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... Circular her4.1 expression plasmids were linearized using XhoI restriction enzyme (New England Biolabs, R0146S) while gfap:EGFP was linearized using ClaI (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... This plasmid was modified using Q5-site directed mutagenesis (New England Biolabs, Ipswich, MA) to first convert the amber stop codon (TAG ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were incubated with 10X Cutsmart buffer and yeast I-SceI endonuclease (NEB #R0694) at 37ºC for approximately 30 minutes prior to injection and then mixed with either Rodamine Green or Alexa488 conjugated Dextran (0.2 mg/ml final concentration) ...
-
bioRxiv - Plant Biology 2023Quote: ... Insert and entry plasmids were digested with PmeI (or SacI) and AvrII enzymes (NEB). Generated fragments were gel extracted ...
-
bioRxiv - Genomics 2023Quote: ... a dual-enSERT-2.1 plasmid (1 μg) was digested overnight with PauI (NEB, R0199) at 50°C in rCutSmart Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmid mini-prep kit and PCR DNA clean-up kits were provided by NEB.
-
bioRxiv - Biophysics 2023Quote: ... the mixture was purified using the Monarch PCR and plasmid DNA purification kit (NEB), eluted in 10 mM Tris-HCl pH8.0 and stored at -20 °C for further experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA2: CCTGACAAGCAATCTGCACG were inserted into lentiCRISPR-V2 (Plasmid #52961) by T4 ligation (NEB, M0202S).
-
bioRxiv - Cell Biology 2023Quote: ... and the parental plasmid was digested with DpnI (New England Biolabs, Ipswitch, MA, USA) prior to transformation into E ...
-
bioRxiv - Cell Biology 2023Quote: ... the plasmids were phosphorylated by T4 Polynucleotide Kinase and ligated by T4 Ligase (NEB).
-
bioRxiv - Biophysics 2023Quote: ... and cloned into pGJJ045 or pGJJ034 digested plasmids with T4 ligase (New England Biolabs) by temperature-cycle ligation following manufacturer instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... gBlocks were created for this sequence with a C-terminal “LPETG” Sortase recognition site and complementary 5’ and 3’ overhangs to the BamHI/HindIII double digested pCARSF63 Thioredoxin-SUMO fusion expression plasmid (Addgene #64695).89 The resulting gBlocks were ligated into pCARSF63 expression plasmids using Gibson assembly (NEB) and transformed into chemically competent SHuffle T7 Express E.coli (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplified plasmid was gel purified and then circularized with KLD Enzyme Mix (NEB, M0554).
-
bioRxiv - Immunology 2023Quote: ... 5 µg of sequencing verified plasmid were restriction digested using BsmBI V2 (NEB, #R0739S) in a 50 µl reaction with NEB3.1 buffer (NEB ...