Labshake search
Citations for New England Biolabs :
9251 - 9300 of 10000+ citations for Human Oxidized low density lipoprotein receptor 1 OLR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: Golden Gate Assembly was performed largely according to the manufacturer protocol included with the NEBridge Golden Gate Assembly kit (New England Biolabs) using the with alterations noted below (Potapov et al ...
-
bioRxiv - Genomics 2024Quote: ... 1µg RNA was used for first strand cDNA preparation by using ProtoScript II Reverse Transcriptase kit followed by Phusion High-Fidelity DNA Polymerase (NEB). RT-qPCR was performed with LunaScript RT Supermix (NEB ...
-
bioRxiv - Zoology 2024Quote: ... The transcriptome sequencing libraries were prepared with poly A selection using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs) and were sequenced using the NovaSeq 6000 instrument (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... rRNA-depleted samples were prepared for next-generation sequencing using NEBNext Ultra II Directional RNA Library Prep kit (NEB; E7765S) and NEBNext Multiplex Oligos for Illumina (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries for RNA-Seq were constructed using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, E7760S), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... after extracting total RNA from the testis (three replicates per genotypes) using the Monarch total RNA mini prep Kit (New England Biolabs), we generated RNA-seq libraries using the NEBNext Rrna Depletion Kit (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... Gene expression levels were quantified by reverse transcription quantitative PCR (RT-qPCR) using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs), and being conducted on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were then prepared from 20ng of input DNA using the NEBNext Ultra-II DNA kit (New England Biolabs) following manufacturer’s instructions22 ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Germany). The size distribution of the libraries was checked by high-resolution gel electrophoresis with a Bioanalyzer instrument using the DNA 7500 Pico kit (Agilent Technologies) ...
-
bioRxiv - Genomics 2024Quote: ... was used as the original tissue sample for genomic DNA extractions with Monarch High Molecular Weight (HMW) Extraction Kit for Tissue (New England Biolabs). Spleen tissue (totaling 25 mg ...
-
bioRxiv - Genomics 2024Quote: Double-stranded DNA libraries were prepared with NEBNext Ultra II DNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (New England Biolab: NEB). Around 1 ng of DNA was used for each library ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA libraries were generated using the NEBNext Ultra II FS DNA Library Prep kit for Illumina (New England BioLabs) in combination with NEBNext multiplex oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR products from divergent primers of expected length were excised and purified via PCR clean up kit (New England Biolabs) for confirmation of BSJ using Sanger Sequencing.
-
bioRxiv - Genetics 2024Quote: ... the Cas9 terminator (TCYC1) was switched to an ADH1 terminator (TADH1) by Gibson assembly using the HiFi DNA Assembly kit (New England Biolabs). Cas9D10A ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA from libraries was prepared according to the instructions of the “NEBNext Ultra Directional RNA Library Prep kit for Illumina” (New England Biolabs), following the “Poly(A ...
-
bioRxiv - Immunology 2024Quote: ... 100 ng of the WTA library was subjected to fragmentation/end-repair/A-tailing using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs). Purified adapter-ligated products were subjected to index PCR ...
-
bioRxiv - Molecular Biology 2024Quote: Libraries of immunoprecipitated DNA were generated from 3 ng of starting DNA with the NEBNext Ultra DNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions at the CRG Genomics Core Facility (Barcelona ...
-
bioRxiv - Neuroscience 2024Quote: ... The remaining steps of library preparation were performed using and the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs). Adapters and PCR primers were purchased from New England BioLabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... indel assay was performed by T7 Endonuclease I-based Mutation Detection with the EnGen® Mutation Detection Kit (NEB #E3321) to detect how efficiently a given sgRNA produces indels at targeted genomic DNA locus ...
-
bioRxiv - Microbiology 2024Quote: ... according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB). Library molarity was measured with the Qubit DNAds HS assay kit from Invitrogen and the quality was analyzed using Bioanalyzer DNA Analysis kit (Agilent ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 300 ng of genomic DNA and used the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) to prepare the libraries ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Neuroscience 2024Quote: ... GDNA was isolated from 7 dpf efemp1+/+ or efemp12C-Cas9 zebrafish eyes using a Monarch Genomic DNA Purification Kit (T3010S; NEB) and quantified using a Nanodrop 1000 (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... genomic DNA was extracted from each homogenized pool of 100 flies using the Monarch Genomic DNA Purification Kit (New England Biolabs). DNA quality was assessed using Nanodrop and quantified with Qubit ...
-
bioRxiv - Developmental Biology 2024Quote: Site-directed mutagenesis was performed on human HMGCR transcript 1 coding sequence in the pCMV-SPORT6 backbone to generate the variants of interest using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). pCMV-SPORT6-hHMGCR1 was a gift from Anne Galy (Addgene plasmid # 86085 ...
-
bioRxiv - Microbiology 2024Quote: ... was amplified using primers OVL7966 and OVL6481 and the PCR product was excised from a 2% agarose gel using the Monarch DNA cleanup and gel extraction kit (NEB). One-step Golden Gate Assembly (GGA ...
-
bioRxiv - Molecular Biology 2024Quote: PCR products amplifying the C-terminal region of CBP in both edited and unedited cells were cleaned up using the Monarch PCR cleanup kit (NEB). DNA concentrations were measured using the Qubit dsDNA BR kit (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L) as described for standard RNA-seq (42) ...
-
bioRxiv - Microbiology 2024Quote: DNA sequencing libraries were prepared from ChIP-seq and Input DNA samples using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... was used to construct sequencing libraries using the NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs, NEB). Libraries were multiplexed using NEBNext Multiplex Oligos for Illumina (dual index primers ...
-
bioRxiv - Microbiology 2024Quote: ... The amplification product of pan-CoV semi-nested PCR was purified and concentrated by the Monarch PCR & DNA Cleanup Kit (NEB), according to the protocol supplied ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Synthesized modRNA was column purified and eluted with 60 µL water using the 50 µg Monarch RNA Cleanup Kit (New England Biolabs). A small sample was nanodropped and ran on a native denaturing gel to determine RNA concentration and verify full-length product ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 200 ng of purified product was used in a 20 µL IVT reaction using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), fully substituting UTP with N1-methylpseudouridine-5’-phosphate (TriLink Biotechnologies ...
-
bioRxiv - Plant Biology 2024Quote: RNA for direct RNA sequencing was extracted from one white petal with the Monarch Total RNA miniprep Kit (New England BioLabs) combined with the manufacturer specific DNase treatment ...
-
bioRxiv - Microbiology 2020Quote: The real-time PCR technique was performed for NDV detection using Luna Universal One-Step RT-qPCR Kit E3005E (New England BioLabs, USA) following the manufacture procedures ...
-
bioRxiv - Plant Biology 2020Quote: ... YFP and CESA6 genomic sequence through Gibson Assembly method using a Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA). The construct was verified by DNA sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µl of extracted RNA was used in a TaqMan one-step qRT/PCR assay (Luna® Universal One-Step RT-qPCR Kit, NEB). TaqMan analysis was carried out with primer/probe combination described in Table 1 and analysis performed on the QuantStudio™ 6 Flex System (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Cell Biology 2019Quote: ... and UBA domain (L309D, M332K/Y334F, and ΔYFLLL) mutants were generated using Q5 Hot Start Site Direct Mutagenesis kit (New England BioLabs, E0552S). BRSK2 domain deletion mutations ΔN (Δ kinase) ...
-
bioRxiv - Cell Biology 2020Quote: ... the pT7-SVmCherry plasmid was first linearised with XhoI and used as a template for in vitro RNA transcription with HiScribe T7 ARCA mRNA kit (New England Biolabs, #E2065S). Transcribed genomic RNA was transfected into BHK-21 using Lipofectamine 2000 reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression of mRNA transcripts for PfRFC1 gene analysis were carried out using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Inc.), on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: E248R deletion mutant proteins of distinct domains (Δ constructs) were generated from E248R WT plasmid by site direct mutagenesis using the Q5 mutagenesis kit (New England Biolabs) as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... The presence of the PCR products was confirmed by gel electrophoresis and the products were then purified by Monarch® PCR & DNA Cleanup Kit (New England Biolabs).
-
bioRxiv - Genetics 2021Quote: For CUT&RUN-sequencing libraries were made starting from 10 ng of CUT&RUN DNA fragments using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S) using the following PCR program ...
-
bioRxiv - Genetics 2021Quote: ... DNase libraries were prepared for sequencing using NEBNext Ultra II DNA Library Prep Kit for Illumina following the manufacturer’s instructions (NEB, cat. # E7645), with double-sided SPRI size selection (Agencourt AMPure XP beads ...
-
bioRxiv - Genetics 2021Quote: ... and a 50-μl aliquot containing between 832-841 ng was provide to the KU Genome Sequencing Core for library construction using the NEBNext Ultra II DNA Library Prep Kit (NEB, E7645L), incorporating unique dual-indexing (NEB ...
-
bioRxiv - Genetics 2021Quote: ... We converted oligo(dT)-selected RNA into a cDNA library for mRNA sequencing using the NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (NEB) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... 50 ng of m6A-containing mRNAs or pre-immunoprecipitated mRNAs (the input) were used for library construction by the NEBNext ultra RNA library preparation kit (NEB, E7530). High-throughput sequencing was conducted on the illumina HiSeq X sequencer with a paired-end read length of 150 bp following the standard protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sequencing libraries were made using the NEB Next Ultra II DNA library kit (New England BioLabs Inc, Ipswich, MA, Cat #E7645S) and were sequenced on the Illumina Hi-Seq4000 using 50bp single-end reads at the Northwestern Sequencing Core (NUCore).
-
bioRxiv - Microbiology 2021Quote: ... A plasmid encoding an eGFP-containing EBOV antigenome was generated through assembly of fragments using the NEBuilder HiFi DNA assembly cloning kit (New England Biolabs (NEB)) ...