Labshake search
Citations for New England Biolabs :
751 - 800 of 1455 citations for Recombinant Mouse Erbb2 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... Fusion proteins were purified in batch by amylose affinity (NEB), eluting in buffer B (buffer A with 0.02% DDM ...
-
bioRxiv - Microbiology 2021Quote: ... and Nico (λDE3) with reduced histidine-rich background proteins (NEB). The RNase I precursor contains a signal peptide (amino acid residues 1-23 ...
-
bioRxiv - Immunology 2021Quote: ... These two proteins were also treated with PNGase-F (NEB) under the reduced condition to remove N-glycans and loaded on the gel to assess the impact of the glycans on the protein size ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein A magnetic beads (New England Biolabs, Ipswich, MA, USA) were then added to the cell lysate and antibody mixture ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μL of lambda protein phosphatase (NEB, Catalog #P0753S) were added to the washed FRQ-coupled V5 resin ...
-
bioRxiv - Microbiology 2022Quote: ... the PURExpress In Vitro Protein Synthesis Kit (New England Biolabs) was used to translate the synthetic transcriptome described above ...
-
bioRxiv - Microbiology 2022Quote: ... A pre-stained protein standard (New England Biolabs, MA, USA) was used to estimate molecular weight ...
-
bioRxiv - Biochemistry 2023Quote: ... The proteins were expressed in BL21(DE3) (New England Biolabs) in LB grown in 2 L baffled shake flasks ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were removed using the Monarch RNA Cleanup Kit (NEB) and 5’-mono-phosphorylated v51_mut_S templates were specifically digested with a terminator 5’-phosphate-dependent exonuclease (Biosearch technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... and Lambda Protein Phosphatase (Lambda PP) was purchased from NEB. After kinase reaction in kinase buffer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The unbound fraction was dephosphorylated using lambda protein phosphatase (NEB), calf intestinal phosphatase (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... and 5 µl of prestained protein ladder (New England Biolabs). The gel was electrophoresed at 150 V ...
-
bioRxiv - Cell Biology 2023Quote: ... in the presence of protein kinase buffer (New England Biolabs) with 3 μCi [γ-32P]ATP ...
-
bioRxiv - Cell Biology 2023Quote: ... kit and co-injected with Cas9 protein (New England Biolabs) into one-cell stage zebrafish eggs ...
-
bioRxiv - Microbiology 2024Quote: ... 50 μL of protein G beads (New England Biolabs (NEB), S1430S ...
-
bioRxiv - Microbiology 2024Quote: ... 50 μL of protein G beads (New England Biolabs (NEB), S1430S ...
-
bioRxiv - Cell Biology 2024Quote: ... STAT1 proteins were dephosphorylated by lambda phosphatase (NEB, Ipswich MA) followed by the addition of protease and phosphatase inhibitors (Thermo Fisher) ...
-
bioRxiv - Genetics 2019Quote: ... Exon 14b was amplified with primers F: GACATGTTGCTAAGATTGAAATCCGT from exon 14 and R: GACCCAGCTTTCAGAGTAACCAGAAC from exon 15 using Phusion polymerase (NEB, Ipswich, MA). The longer band containing exon14b was then excised from the gel and purified using Zymoclean gel DNA recovery kit (Zymoresearch ...
-
bioRxiv - Developmental Biology 2021Quote: ... touchdown PCR (with primers atg13 F- GGCTCGTGCGACAATGGATAGTG; R- GACCTCGGGGATGTCCTTTATTGC) was followed by a HindIII restriction digest (R3104S, New England Biolabs, MA, USA), and fragments were separated by gel electrophoresis on a 3% agarose gel ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were propagated in Escherichia coli NEB Turbo ((F’ proA+B+ lacIq ΔlacZM15/fhuA2 Δ(lac-proAB) glnV galK16 galE15 R(zgb-210::Tn10) TetS endA1 thi-1 Δ(hsdS-mcrB)5)) (New England Biolabs) at 37°C in lysogeny broth (LB ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were stained with mouse anti-MBP (NEB, 1:500), followed by washing and subsequent incubation with goat anti-mouse IgG ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were stained with mouse anti-MBP (NEB, 1:500), followed by washing and subsequent incubation with goat anti-mouse IgG ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse α-myc (New England Biolabs, clone 9B11, 1:2,000), rabbit α-pol-I largest subunit 15 (1:100 ...
-
bioRxiv - Biochemistry 2023Quote: ... mouse monoclonal antibodies against PAR (clone 10H, Tulip BioLabs, USA), anti-mouse antibodies conjugated with horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Genetics 2024Quote: ... and mid-range PFG ladder (for mouse samples) (NEB Inc.) and 1 kb ladder (GeneDirex Inc.) ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein dephosphorylation was performed on total WT and MLP knockout heart lysates by using Alkaline Phosphatase (rSAP)(M0371S NEB, 1U of rSAP/10mg of protein). The protein lysate containing phosphatases ...
-
bioRxiv - Microbiology 2020Quote: ... The soluble proteins were mixed with amylose resin (New England Biolabs) according to the manufacturer’s protocols.
-
bioRxiv - Molecular Biology 2020Quote: The protein was expressed in NiCo21 (DE3) cells (New England Biolabs) grown in Overnight Express Instant TB Medium (EMD Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... supplemented with DTT and proteins were degraded using proteinase K (NEB). Total cellular RNA was purified using the RNeasy maxi kit (QIAGEN ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cas9 protein (New England Biolabs, #M0646M, EnGen Cas9 NLS 20 μM) and 300 pg of sgRNAs along with 5 ng of GFP cRNA were co-injected into the X ...
-
bioRxiv - Developmental Biology 2021Quote: ... in equimolar ratios and EnGen®Spy Cas9 NLS protein (NEB) into 1-cell zebrafish embryos.
-
bioRxiv - Immunology 2021Quote: ... Deglycosylation was performed on beads using Protein Deglycosylation Mix II (NEB) in denaturing conditions according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... associated with EnGen™ Spy Cas9 NLS protein (New England BioLabs), using the 4D-Nucleofector™ System (Lonza ...
-
bioRxiv - Physiology 2020Quote: ... were co-injected with 0.5 μl Cas9 protein (NEB, M0386, 20μM), diluted 1:10 ...
-
bioRxiv - Cell Biology 2019Quote: ... MBP-MKLP1 proteins were purified on amylose resin (New England Biolabs), washed 5 times with Washing Buffer (50 mM Tris-HCl pH 7.5 ...
-
Cdc42 promotes epithelial morphogenesis by coupling Par-complex and Crumbs recruitment via Par6-aPKCbioRxiv - Cell Biology 2019Quote: ... MBP-fusion proteins were purified using Amylose resin (New England Biolabs), washed in lysis buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... Molecular weights were identified using a protein standard (BioLabs, Cat# P7712S). Beta-actin was used as the loading control ...
-
bioRxiv - Biochemistry 2020Quote: ... morsitans salivary proteins were treated with PNGase F (New England Biolabs), resolved by SDS-PAGE and transferred onto a PVDF membrane (GE Healthcare ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 µl of lambda protein phosphatase (New England BioLabs, Ipswich, MA). Each mixture was incubated at 30 °C for either 1 ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were then coupled to protein G beads (New England Biolabs). After beads were washed ...
-
bioRxiv - Plant Biology 2020Quote: ... the purified proteins (0.125 mg) or RNase If (1.25 U; NEB) were incubated at 25°C for 60 minutes with a fluorescent-labeled RNA substrate (5’-fluorescein isothiocyanate (FITC)-CUUUUAG(A20) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and α1-3,4 fucosidase (New England Biolabs, 4 U/μg protein). All enzymatic reactions were performed as a 1-step reaction with 1x Glycobuffer 2 (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... Molecular weights were determined using protein standards (New England Biolabs P7719).
-
bioRxiv - Molecular Biology 2021Quote: ... The protein was then digested with LysC endoproteinase (0.25 µg; NEB) for 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... MBP fusion proteins were purified on amylose beads (New England Biolabs) in column buffer (20mM Tris pH 7.4 ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein was first bound to amylose resin (New England Biolabs). Afterwards ...
-
bioRxiv - Cancer Biology 2019Quote: ... After cooling 5 µl Protein Deglycosylation Mix II (New England Biolabs) was mixed in gently ...
-
bioRxiv - Bioengineering 2020Quote: IVPS was performed using PURExpress In Vitro Protein Synthesis Kit (NEB) with supplements (16 U RNase inhibitor (NEB) ...
-
bioRxiv - Pathology 2021Quote: ... Soluble protein extracts were purified using amylose resin (New England Biolabs) and/or Ni-NTA agarose beads (Life Technologies).
-
bioRxiv - Microbiology 2020Quote: ... Magnetic beads conjugated with IgG Protein A/G (New England Biolabs) were pre-blocked with 0.5 mg/mL of sonicated salmon sperm DNA (Thermo Scientific ...