Labshake search
Citations for New England Biolabs :
651 - 700 of 1455 citations for Recombinant Mouse Erbb2 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... and 0.4 μg of T4 gene protein (NEB, M0300S)] ...
-
bioRxiv - Microbiology 2021Quote: ... 9 Neuraminidase A (P0722, NEB, 4 units/µg protein). 10 µg glycoprotein ...
-
bioRxiv - Microbiology 2020Quote: ... anti-maltose binding protein (MPB) (New England BioLabs #E8032L) and anti-outer membrane protein (OmpA ...
-
bioRxiv - Cell Biology 2020Quote: ... against a Color Protein Standard broad range ladder (NEB) in NuPAGE MES SDS buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μL of Lambda Protein Phosphatase (New England Biolabs) or 1 μL of phosphatase inhibitor mix (20 mM β-glycerophosphate ...
-
bioRxiv - Developmental Biology 2021Quote: ... A pre-assembled complex of purified Cas9 protein (NEB) and gRNA was injected and the efficiency of Crispr/Cas9-induced mutagenesis in the F0 generation monitored at 24 hpf using a T7 endonuclease assay (Jao et al. ...
-
bioRxiv - Microbiology 2020Quote: ... RNA-protein complexes were dephosphorylated with T4 PNK (NEB) for 45 minutes in an Eppendorf Thermomixer at 37°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 μM of purified proteins mixed with PEG8000 (NEB) at 10% (w/v ...
-
bioRxiv - Biophysics 2019Quote: ... fusion proteins were directly biotinylated with BG-Biotin (NEB), buffer exchanged with a Zeba Desalting Column (ThermoFisher ...
-
bioRxiv - Plant Biology 2021Quote: ... MBP-MYB6 protein was purified on amylose resin (NEB) and HIS-PUB26 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Protein expression plasmids were cloned using Gibson Assembly (NEB Gibson Assembly Master Mix ...
-
bioRxiv - Synthetic Biology 2020Quote: The protein samples of purified ribosome (New England BioLabs), E ...
-
bioRxiv - Genetics 2020Quote: ... 90 nM of SpCas9 protein (#M0386, New England Biolabs), NEB buffer 3.1 ...
-
bioRxiv - Neuroscience 2020Quote: ... H1 was transfected with pre-assembled Cas9 protein (NEB) + crRNA and tracrRNA (Synthego) ...
-
bioRxiv - Immunology 2021Quote: ... 90 nM of EnGen® Sau Cas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The supernatants were used with lambda protein phosphatase (NEB) treatment according to its protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... using a commercially available Cas9 protein (New England Biolabs). The efficiency of creating deletion after co-injection of the sgRNA pair was determined by PCR on genomic DNA extracted from injected embryos using the following primers:
-
bioRxiv - Molecular Biology 2022Quote: ... The eluted protein was applied to Amylose resin (NEB) equilibrated with buffer D (20 mM Tris-HCl ...
-
bioRxiv - Microbiology 2022Quote: ... 30 μg of Protein G magnetic beads (NEB #S1430) was washed with 250 μl of Immunoprecipitation Reaction Buffer (150 mM NaCl ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instructions (Lambda protein phosphatase, Biolabs). Western blot analysis was followed with an antibody against GFP (1:1000 ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instructions (Lambda protein phosphatase, Biolabs). In parallel ...
-
bioRxiv - Bioengineering 2023Quote: ... Tagless protein was expressed in Lemo21(DE3) cells (NEB) in LB (10 g Tryptone ...
-
bioRxiv - Biochemistry 2023Quote: ... The protein was first purified on amylose resin (NEB) in a buffer containing 20 mM Tris pH 8 ...
-
bioRxiv - Cell Biology 2023Quote: ... Biotinylated proteins were separated on magnetic streptavidin resin (NEB) and eluted with 2× SDS loading buffer supplemented with 4% SDS and 10 mM Β-mercaptoethanol ...
-
bioRxiv - Immunology 2023Quote: ... color prestained protein standard (New England Biolabs GmbH, Germany) was included on each gel ...
-
bioRxiv - Biophysics 2023Quote: ... The sample was phosphorylated using protein kinase A (NEB) and then further purified on size exclusion chromatography.
-
bioRxiv - Developmental Biology 2023Quote: ... Synthesized sgRNA was mixed with Cas9 protein (NEB# M0646T) just before microinjection into zebrafish embryo.
-
bioRxiv - Biophysics 2023Quote: ... Proteins were cleaved with TEV protease (New England Biolabs) and further purified via reverse IMAC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were subsequently purified on amylose resin (E8021L, NEB): 3 ml resin per column and 45 ml of extract ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein A beads (10 µl, New England Biolabs, #S1425) were washed twice in coIP-solution and consecutively incubated for 1 hour at 4°C with an anti-synaptopodin antibody (rabbit anti-Synaptopodin ...
-
bioRxiv - Cell Biology 2024Quote: ... RRID:Addgene_119754).CAPS-GST protein was expressed in BL21Star bacteria (NEB); the protein was isolated by binding to glutathione-Sepharose (Pierce ...
-
bioRxiv - Neuroscience 2024Quote: ... 25-50 ul Protein G Magnetic Beads (NEB #S1430S) were incubated with 3ug GFP (D5.1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... cloned into the pJR16 vector in two steps (Gift from R. Johnston, Johns Hopkins University) using HiFi DNA Assembly (New England Biolabs). pJR16 uses an EGFP reporter with a nuclear localization sequence (nls) ...
-
bioRxiv - Cell Biology 2020Quote: To prepare single guide RNA targeting MTFR2, DNA oligoes (F: CACCGACGACATTTACCTGTTCTAC, R: AAACGTAGAACAGGTAAATGTCGTC) were annealed and cloned into BsmBI (NEB) cut pLenti-sgRNA to make pLenti-sgMTFR2 following published protocols (Ran ...
-
bioRxiv - Biochemistry 2020Quote: ... Modification of the coding sequence of the multibasic S1/S2 cleavage site PRRAR to PGSAS or to a single R was carried out by PCR mutagenesis using Q5 polymerase (New England Biolabs). Introduction of cysteine crosslinks and modification of residues 986 and 987 were carried out using Q5 polymerase PCR with primers containing desired substitutions ...
-
bioRxiv - Neuroscience 2021Quote: ... Either the wild-type or the mutant version of the PRNP 3’U R were inserted into the digested pmirGLO vector by performing a Gibson Assembly following manufacturer`s instructions (NEB). After transformation of the cloned vectors and purification of the DNA using EndoFree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... a 2.4-kb PCR fragment spanning Rv3377c-Rv3378c was generated using primers BamHI-Rv3377c-Rv3378c-F and HindIII-Rv3377c-Rv3378c-R (Sup. Table 1) using high-fidelity Phusion DNA polymerase (New England Biolabs). The fragment was subsequently digested with BamHI and HindIII (all restriction enzymes from New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... αlvus tRNAPyl (Ma-tRNAPyl)35 was prepared by annealing and extending the ssDNA oligonucleotides Ma-PylT-F and Ma-PylT-R (2 mM, Supplementary Table 1) using OneTaq 2x Master Mix (NEB). The annealing and extension used the following protocol on a thermocycler (BioRad C1000 Touch™) ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Sec22b-shR and EGFP-Sec22b-P33-shR were generated by site-directed mutagenesis (F: CTTCTGAATGAAGGTGTCGAACTCGATAAAAGAATAAGGCCTAGACACAGTGGGC; R: GCCCACTGTGTCTAGGCCTTATTCTTTTATCGAGTTCGACACCTTCATTCAGAAG) using the Q5 Site-Directed Mutagenesis Kit (NEB). pEGFP-ORP8-H514A-H515A (ORP8-Mut ...
-
bioRxiv - Biophysics 2019Quote: ... This fragment was PCR-amplified with the oligonucleotides 89.F lambda 40002 XhoI and 90.R lambda 45263 ApaI using Lambda DNA (NEB) as a template ...
-
bioRxiv - Genetics 2021Quote: ... 5’TTGGNNN…NNNGTTTAAGAGC3’and Oligo R: 5’TTAGCTCTTAAACNNN…NNNCCAACAAG3’) and ligating them together with the linearized vector using the T4 DNA ligase enzyme (NEB).
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Genetics 2020Quote: ... the ‘T2A-GFP-WPRE’ sequence was amplified from the hVMD2-hBEST1-T2A-GFP plasmid using LCv2-GFP.Gib.F and .R primers and Q5 2X MM (NEB, Cat# M0492L). The ‘2A-Puro-WPRE’ sequence was then removed from the LCv2 plasmid via restriction digestion with PmeI (NEB ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... DNA fragments were amplified with 15-20 bp of homology regions in primers using Phusion R High Fidelity DNA polymerase (New England Biolabs; NEB) and homology based assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Immunology 2023Quote: ... Candidate founders giving positive products in all three PCR reactions were further characterised by amplifying again with the JG01 F/R primers using high fidelity Phusion polymerase (NEB), the larger product gel extracted and subcloned into pCRblunt (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... 10μg of undigested total RNA samples and the above-mentioned RNase R-treated RNA were added with RNA loading dye (NEB) and denatured for 10min at 70°C ...
-
bioRxiv - Biochemistry 2023Quote: ... with the Metadynminer R package.52 Minimum free energy paths (MFEPs) were obtained through the Metadynminer package with the nudged elastic band (NEB) method linking intermediate wells.53 Concerted pathways were obtained by NEB directly from the reactants to the products ...
-
bioRxiv - Cell Biology 2023Quote: ... zact sequence was amplified with primers containing attB sites (F: GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGATGAGGAAATCGCTG; R: GGGGACCACTTTGTACAA-GAAAGCTGGGTAGAAGCACTTCCTGTGGACGATG) using a high-fidelity polymerase (Phusion, NEB). To create a middle entry clone pME-zact ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pET21c-GPR-EGFP vector was PCR-linearized with pET-F/R and pre-digested with HindIII-HF and XhoI (NEB). The insert was ligated to the vector in a 3:1 ratio (insert:vector ...
-
bioRxiv - Cell Biology 2023Quote: ... and GST-Elm1-R (GATGCGGCCGCTCGAGCTATATTTGACCATTATCTGCAAAG) to amplify each Elm1 phospho-mutant and cloned into pGEX-4T1 using BamHI and XhoI (New England Biolabs). All plasmid constructs and mutagenesis were confirmed correct via sequencing at the DNA Sequencing Facility ...