Labshake search
Citations for New England Biolabs :
551 - 600 of 1455 citations for Recombinant Mouse Erbb2 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... so the bead-bound proteins were dephosphorylated in wash buffer containing 1:50 Lambda Protein Phosphatase (New England Biolabs) and 1 mM MnCl2 to make the phosphosites more accessible for a kinase assay ...
-
bioRxiv - Microbiology 2022Quote: ... Deglycosylation of purified protein was performed in non-denaturing conditions according to manufacturer’s protocol (Protein Deglycosylation Mix II, NEB).
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting amplicons were end-labeled with [γ-32P] dATP (Perkin-Elmer) in the presence of T4 polynucleotide kinase (New England BioLabs), after which they were centrifuged through a TE Select-D G-25 spin column (Roche Applied Science ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were complimentary to the 3′-UTR regions immediately adjacent to the poly(A) tails and were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 200 ng of the purified amplicon were end-labeled using 10 µCi of γ-32P ATP (Amersham) and T4 polynucleotide kinase (NEB). The labeling reaction was then desalted on a G-25 spin column and further precipitated with 70% ethanol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The single-stranded labeled probes were finally cleaned up using the Monarch PCR & DNA cleanup kit (New England Biolabs®, T1030) following the oligonucleotide cleanup protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... 32P were then labeled to 5’ end of digested RNA by T4 Polynucleotide Kinase (PNK) (New England Biolabs, Cat. No. M0201S). After labelling ...
-
bioRxiv - Genetics 2022Quote: ... Specific sRNAs were detected by hybridization with DNA oligonucleotides labeled at their 5’ termini with [γ-32P]ATP and T4 Polynucleotide Kinase (New England Biolabs) as previously described (Ibrahim et al. ...
-
bioRxiv - Developmental Biology 2020Quote: A digoxin-labeled human H19X probe was transcribed in situ from a linear template plasmid by T7 RNA polymerase (NEB, UK) with Digoxin-labeled Uridine (Roche ...
-
bioRxiv - Genomics 2022Quote: The 2.2 kb DNA was ligated with 1 kb biotin- and dig-labeled DNA through SbfI- and XbaI-overhangs by T4 DNA ligase (NEB Biolabs). The ligated products were attached to the anti-dig treated surface of reaction chamber and streptavidin-coated magnetic beads ...
-
bioRxiv - Cell Biology 2023Quote: ... The odf3l2a template was amplified from total RNA with T3 and T7 sites on the forward and reverse primers respectively and the DIG-labeled antisense probe was synthesized directly from purified PCR product using T7 RNA polymerase (NEB M0251S). The ankef1a and saxo2 probe templates were amplified from total RNA with gene specific primers and cloned into the pCR4-TOPO vector (Thermo Fisher 450071) ...
-
bioRxiv - Biochemistry 2023Quote: ... oligonucleotide X12-3 HJ3 (93 nt) was labeled at the 5’ terminus with [γ-32P] (Hartmann-Analytic) and T4 polynucleotide kinase (New England Biolabs), according to standard protocols65 ...
-
bioRxiv - Microbiology 2023Quote: ... DNA probes complementary to the sequence of each sRNA were end-labeled with [μ-32P]dATP (Perkin-Elmer) and T4 polynucleotide kinase (New England BioLabs) as described before (28 ...
-
bioRxiv - Microbiology 2023Quote: ... and vcircRNA873/1151 (oligonucleotide probe 5’- CAGGACAACAGGGCCAGCAAGGTGGCGGACATCACAACCA-3’ against the junction) were performed using γ-32P-dATP-end labeled (PNK kinase, NEB) probes ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were live labeled with 1 μM ATTO 590-chloroalkane and 1 μM of SNAP-Cell 647-SiR (New England Biolabs; S9102S) (final concentrations) ...
-
bioRxiv - Genetics 2023Quote: ... using a biotin-labeled 30 μM dNTP mix (dATP, dGTP, dTTP and Biotin-14-dCTP Thermo Fischer, 19518018) and Klenow enzyme (NEB, M0210L) at 37°C for 80 min ...
-
bioRxiv - Biochemistry 2023Quote: ... The indicated oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA oligonucleotides complementary to miRNA sequences were end-labeled with γ-32P-ATP using T4 PNK (New England Biolabs, Beverly, MA).
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Cell Biology 2024Quote: ... were obtained from HeLa cells co-transfected with mGFP-Sec16L at 3 µg/µL and FLAG-TFG-SNAP at 1 µg/µL and subsequently labeled with SNAP-Cell 647-SiR (NEB, S9102S) and immunostained with anti-GM130 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal anti-MBP (1:2000, NEB), rabbit polyclonal anti-Spo11 (1:1000 ...
-
bioRxiv - Biochemistry 2022Quote: ... MBP (mouse, 1:30,000, New England Biolabs), FLAG (mouse ...
-
bioRxiv - Genomics 2019Quote: ... Pools were PCR amplified using 10uM Illumina primer pair (F+R) and 2X Phusion Master Mix (NEB #M0531), temperature cycling consisted of 98°C for 30s ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Molecular Biology 2021Quote: ... R: 5’-ccgggaaaaactgaaaaaccattggcacgacaggtttcccgac-3’ from the pKAM555 vector) was inserted at the ClaI site using HiFi assembly (NEB). For the intTEL0 strain creation the pUC19LG plasmid (lacking the PstI(blunted)-BclI fragment of the HARS36 sequence ...
-
bioRxiv - Genetics 2023Quote: ... The T7 promoter and mtdTomato CDS were amplified from pmrPTRE-AAV using PTRE_floxed_F/R and Phusion High-Fidelity PCR Master Mix (NEB). NotI and SalI sites added by the primers were used to subclone this amplicon into pRM1506_TMM432 ...
-
bioRxiv - Cell Biology 2023Quote: ... For an R-loop negative control the preparation was treated with 5 U RNaseH (M0297S, NEB Japan, Japan) in 1× RNaseH Reaction Buffer (NEB Japan ...
-
bioRxiv - Microbiology 2023Quote: ... U6-del-F and U6-del-R (Supplementary table 4) were annealed and phosphorylated using T4 PNK (NEB) and ligated into the restricted plasmid using T7 DNA ligase ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated for 30 minutes shaking at 1.500 rpm at room temperature with protein extract (500 µg of whole cell protein extract or 150 µg of CPE) and murine RNase Inhibitor (NEB) in the corresponding protein extraction buffer (without glycerol) ...
-
bioRxiv - Biophysics 2019Quote: ... uncleaved fractions and 3C protease were removed by Ni-chelated sepharose and the G protein was dephosphorylated by lambda protein phosphatase (NEB), calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: 750000 cells were harvested and resuspended in 40 μL lambda protein phosphatase reaction buffer (1X NEBuffer Pack for Protein MetalloPhosphatases (NEB), 1mM MnCl2 (NEB) ...
-
bioRxiv - Plant Biology 2021Quote: The MBP-NbERF-IX-33a fusion protein was prepared using the pMAL Protein Fusion and Purification System (New England Biolabs). E ...
-
bioRxiv - Plant Biology 2020Quote: ... and an aliquot containing 10 µg protein was treated with lambda protein phosphatase reaction mix following the instructions of the manufacturer (New England Biolabs) for 1 h at 30°C.
-
bioRxiv - Cell Biology 2019Quote: ... were expressed as fusion proteins with an N-terminal maltose binding protein (MBP)-tag using the pMALTMc5x-vector (New England Biolabs). Cloning was mediated by the addition of the restriction sites XmnI/PstI to the ends of gene fragments PCR-amplified from P ...
-
bioRxiv - Plant Biology 2023Quote: ... The MBP-OsTLP protein or the MBP control protein was bound to amylose resin (New England Biolabs, Beverley, MA, USA), and then the LssaCA-His protein was added to the beads ...
-
bioRxiv - Plant Biology 2024Quote: ... An aliquot containing 10 mg of protein was then subjected to lambda protein phosphatase reaction mix following the manufacturer’s instructions (New England Biolabs, US) for 1 hour at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 μL of magnetic beads protein A (NEB) were added to the mixture and incubated for 4 h at 4°C on a rotating wheel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were transferred to nitrocellulose membranes (Biolabs, 1620115). Membranes were then incubated with primary antibody diluted in 5% milk or 2.5% BSA in Triton X-100-TBS buffer (T-TBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... we injected Cas9 mRNA or protein (NEB, M0646T) with corresponding sgRNAs into 1-cell wild-type Tuebingen embryos ...
-
bioRxiv - Developmental Biology 2021Quote: Protein extraction was performed with RIPA buffer (NEB) in the presence of protease and phosphatase inhibitors (Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... Proteins with or without PNGase F (NEB, USA) digestion were mixed with the loading buffer (250Mm Tris-HCl PH 6.8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 90 nM of SpCas9 protein (New England Biolabs), Cas9 nuclease buffer (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... PNGase F (P0704, NEB, 1,000 units/µg protein) was used to remove the N-linked glycosylation in purified ORF8 protein ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were treated with Lambda Protein Phosphatase (NEB) for 30 min at 30 °C followed with an additional four times washing step before they were blocked ...
-
bioRxiv - Microbiology 2020Quote: ... and proteins were purified with amylose resin (NEB) and eluted with 20 and 50 mM maltose (Sigma).
-
bioRxiv - Plant Biology 2021Quote: ... All proteins were purified using Amylose Resin (NEB) or HisPur Cobalt Resin (Thermo ...