Labshake search
Citations for New England Biolabs :
701 - 750 of 1455 citations for Recombinant Mouse Erbb2 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... AlkB D135S and AlkB D135S/L118V were mixed and incubated with 1 pmol of a synthetic RNA oligonucleotide carrying m1A or m1G at the 5’-end (m1AUGCACUUGGACGAACCAGAGUGUAGCUUAA, IBA Sciences; m1GGCGCAGCGGAAGCGUGCUGGGCCCA, kindly provided by R. Micura) previously 32P-labelled with T4 PNK (NEB), and 500 ng total RNA extracted from HAP1 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... and protein samples and molecular weight markers (PageRuler Plus Pre-stained Protein Ladder, ThermoFisher Scientific 26619, or Colour pre-stained protein standards NEB P7712 or P7719) were separated using 8% ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 % SDS-PAGE gel was prepared and 50 μg of protein lysate was loaded along with the protein standard ladder (Cat.No.: P7719S, New England Biolabs, Ipswich, Massachusetts, United States), and electrophoresis was performed for 1.5 hr in ice-cold 1x Laemmli electrophoresis running buffer ...
-
Cdc42 promotes epithelial morphogenesis by coupling Par-complex and Crumbs recruitment via Par6-aPKCbioRxiv - Cell Biology 2019Quote: ... anti-MBP mouse 1/80,000 (E8032S, New England Biolabs). Western Blots were quantified using Fiji ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-myc (NEB/Cell Signaling, 2276; 1:1500) o/n at 4 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary mouse antibodies against MBP (NEB E8032L, 1:5000) and RAD51 (Novus Biologicals 14b4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse monoclonal anti Pan-Keratin (clone C11, NEB, 4545S). Primary antibodies were incubated with sections overnight at 4°C except for anti-CD3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: The library of plasmids pSB/IR-CA-HybIntr-2×99intr-SV40intr-BleoR-T2A-mCherry was obtained by cloning of the library of DNA duplexes generated by renaturation of oligonucleotides 130-99intr-F and 131-99intr-R (with completion of complementary DNA T4 strands with DNA-polymerase and restriction by endonucleases BsaI (NEB, USA) and KpnI ...
-
bioRxiv - Biophysics 2021Quote: ... Mutagenic PCR to obtain the D614G amino acid change into both untagged and 161/345A4-tagged SΔTM constructs was done using the primers S2_D614_Q5-F and S2_D614_Q5-R (Table S1) and the Q5® Site-Directed Mutagenesis Kit (NEB®, Ipswich, MA, USA) according to the manufacturer instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Paired oligos (sgRNA-F and sgRNA-R; see Table S8) with 5′ overhangs were first treated with T4 polynucleotide kinase (NEB, M0201), then cooled from 95°C to 4°C at a 0.1°C/sec ramp rate ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplifications of rbcL sequences were performed with the RbcL-M-F and RbcL-M-R primers using PCR Ready Mix (BioLabs, Israel), and 50ng DNA-template ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... DNA fragments were amplified with 15-20 bp of homology regions in primers using Phusion R High Fidelity DNA polymerase (New England Biolabs; NEB) and homology based assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... and MpERF20 cds in situ R (5’ GTACAAGAAAGCTGGGTCGGCGCGCCttacatgagtgggggaactaaaagaagagt-3’) and seamlessly cloned using NEBuilder HiFi DNA Assembly (New England Biolabs, #E5520) into pENTR-D linearized with NotI/AscI ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Genetics 2024Quote: ... 400 nM of each of the flanking primers PS1057-NGS-F and PS1057-NGS-R (S2 File) and 0.1 units/µl of LongAmp Taq DNA polymerase (NEB Cat. # M0323L). In a second amplification step ...
-
bioRxiv - Molecular Biology 2021Quote: ... Analytical amounts of twenty Argonaute proteins were synthesized from pET29a plasmids using PURExpress In Vitro Protein Synthesis kit (New England Biolabs, Inc., Ipswich, MA, USA). For large scale expression and purification of CbAgo ...
-
bioRxiv - Biophysics 2021Quote: ... The E1371Q samples were phosphorylated using protein kinase A (NEB). The wild-type sample was de-phosphorylated using λ-phosphatase ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 µl 10x buffer for Protein MetalloPhosphatases (New England Biolabs), and 5 µl 10 mM MnCl2 for 30 min at 30 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins associated to chromatin (pellet) were treated with DNaseI (NEB). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... both proteins were deglycosylated by PNGase F (NEB, 1:50) overnight at 37°C in PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... A slurry of protein A or G magnetic beads (NEB) was used to capture enriched chromatin ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were digested using 4µl Proteinase K (800U/ml, NEB) and incubation at 55°C for 2h ...
-
bioRxiv - Synthetic Biology 2019Quote: The PURExpress in vitro protein synthesis kit (New England BioLabs) was used to transcribe and translate Were-1-Fluc ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The protein was digested with PNGase F (New England BioLabs) under denaturating conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... The protein was purified on amylose resin beads (E8021S, NEB) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Fusion proteins were purified in batch by amylose affinity (NEB), eluting in buffer B (buffer A with 0.02% DDM ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein/lysate sample de-N-glycosylation using PNGase F (NEB), Endo S (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... Eluted protein samples flowed through Amylose resin (New England Biolabs) for a second step of affinity purification ...
-
bioRxiv - Neuroscience 2020Quote: ... Ca2+/calmodulin-dependent protein kinase II (CaMKII, New England Biolabs).
-
bioRxiv - Cell Biology 2020Quote: ... Blue Protein Standard Broad Range (New England Biolabs, Hitchin, UK) was used as a protein marker ...
-
bioRxiv - Cell Biology 2020Quote: ... 75 µl of protein G magnetic bead suspension (S1430, NEB) pre-equilibrated in lysis buffer was added to each tube and incubation continued for additional 1 h at +4□C ...
-
bioRxiv - Biophysics 2022Quote: ... Fusion proteins were purified in batch by amylose affinity (NEB), eluting in buffer B (buffer A with 0.02% DDM ...
-
bioRxiv - Cancer Biology 2022Quote: ... purified GST-fusion proteins were incubated with CK2 enzyme (NEB) in 20μl kinase buffer (20mM Tris-HCI [pH 7.5] ...
-
bioRxiv - Molecular Biology 2022Quote: ... O-glycosidase (New England Biolabs, 20 000 U/μg protein), α2-3,6,8 neuraminidase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... α2-3,6,8 neuraminidase (New England Biolabs, 25 U/μg protein) and α-N-acetyl-galactosaminidase (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1x NEB-uffer for Protein Kinases (New England Biolabs). The samples were then subjected to protein precipitation ...
-
bioRxiv - Biochemistry 2021Quote: 10 ug of protein extract were digested with PNGaseF (NEB) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... 1X protease inhibitor cocktail ± lambda protein phosphatase (New England Biolabs) as per the manufacturer’s instructions and incubated at 30°C for one hour.
-
bioRxiv - Cell Biology 2022Quote: ... samples were treated with Lambda Protein Phosphatase (New England BioLabs). We found that for efficient dephosphorylation of CSF extract samples ...
-
bioRxiv - Microbiology 2022Quote: Experiments with PURExpress in vitro protein synthesis kit (NEB, E6800) were performed as per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The Cas9nls protein was obtained from NEB (cat number M0646T).
-
bioRxiv - Synthetic Biology 2022Quote: We used PURExpress In Vitro Protein Synthesis Kit (NEB, E6800L) and the reaction was set up with the following manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2019Quote: ... 100 ng of T4 gene 32 protein (New England Biolabs), and 3× PrimeScript enzyme mix (Cat# RR037A ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas9 protein (IDT) was suspended with a Diluent B (NEB) to make 1 μM solution ...
-
bioRxiv - Synthetic Biology 2020Quote: We analyzed protein digests of purified ribosome (New England BioLabs) and purified LacZ (FUJIFILM Wako Pure Chemical Corporation ...
-
bioRxiv - Developmental Biology 2019Quote: ... Blue pre-stained protein standard (11-190kDa) (New England Biolabs) was used ...
-
bioRxiv - Genomics 2020Quote: ... The APOBEC3A protein was produced by (NEB E7133, Ipswich, MA).