Labshake search
Citations for New England Biolabs :
6951 - 7000 of 10000+ citations for Protein Digestion kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: Sequencing libraries were prepared from 1µg RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Incubation time for fragmentation of total RNA was 6 mins and no size selection was performed ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were generated using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Preparation of genomic DNA libraries was carried out using the NEBNext Ultra II FS DNA Library Prep Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries for sequencing were prepared using NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs, E7465). Libraries were sequenced on an Illumina HiSeq 1500 instrument at the Laboratory of Functional Genomic Analysis (LAFUGA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Strand-specific libraries were prepared with the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs). Indexed ...
-
bioRxiv - Cancer Biology 2021Quote: ... the purification of PolyA containing mRNA molecules using poly-T oligo attached magnetic beads from 1μg total RNA (with the Magnetic mRNA Isolation Kit from NEB), a fragmentation using divalent cations under elevated temperature to obtain approximately 300bp pieces ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB E7760S) with the NEBNext Poly(A ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries with single index were prepared using the NEBNext DNA library prep kit (New England BioLabs, Ipswich, MA) and then sequenced on the Illumina MiSeq sequencing platform (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... sequencing libraries were generated using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (Cat.No. E7770L, NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: Libraries of genomic DNA were generated for each sample with the Illumina TruSeq DNA Sample Prep Kit (BioLABS, Germany). Details of the sequencing are shown in Tab ...
-
bioRxiv - Microbiology 2020Quote: ... SCV2 RNA was quantified using a NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs, E3006) and 2019-nCoV CDC N1 primers and probes (IDT ...
-
bioRxiv - Microbiology 2021Quote: ... The entire ORF of mucoricin was PCR amplified from cDNA using Phusion High-Fidelity PCR Kit (New England Biolabs) using the primers 5’-GATAAGACTAGTATGTATTTCGAAGAAGGC-3’ and 5’-GGTGATGCACGTGTCCTTCAAATGGCACTA-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... Additional S/A and S/D mutations were generated by using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... elegans and mouse cDNA (PolyATtract® mRNA Isolation Systems, Promega and ProtoScript® First Strand cDNA Synthesis Kit, NEB). Detailed sub-cloning information is available upon request.
-
bioRxiv - Cancer Biology 2020Quote: ... and ligation to adapters with “NEBNext Ultra II DNA Library Prep Kit for Illumina” (New England BioLabs, ref. E7645). Adapter-ligated libraries were completed by limited-cycle PCR and extracted with a single double-sided SPRI size selection ...
-
bioRxiv - Immunology 2020Quote: ... Library construction for RNA-seq was performed using NEBNext RNA Ultra I kit (New England Biolabs, catalog number E7530L) with polyA mRNA isolation module (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... The alkyne-PAR was purified to remove excess alkyne-PEG1-amine using the Monarch Nucleic Acid Cleanup Kit (NEB) following the recommended protocol ...
-
bioRxiv - Microbiology 2021Quote: ... catalytic MTase mutant of AMt2 (AMt2-C78G) was generated via site-directed mutagenesis (NEB, Q5 Site-Directed Mutagenesis Kit), using primers listed in the primer table (Table S1) ...
-
bioRxiv - Microbiology 2021Quote: ... library preparation using the NEBNext® Ultra™ Directional Library Prep Kit for Illumina® (New England Biolabs, USA), and subsequent 150-bp paired-end RNA sequencing on a HiSeq 2500 sequencer (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... RNA sequencing library preparations were performed using NEBNext Ultra RNA Library Prep Kit for Illumina following manufacturer’s recommendations (New England Biolabs). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... pET28b-StcEE447D-Δ35-NHis and pRSETA-BT4244E575A were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) with primers listed in Table 1.
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries were prepared using the NEBNext Ultr II Directional RNA Library Prep Kit for Illumina (New England Biolabs). After indexing ...
-
bioRxiv - Biophysics 2021Quote: DNA assembly one-step multiple fragment cloning technique (NEBuilder HiFi DNA assembly cloning kit, E5520, New England Biolabs, MA). We ligated the assembled products into a pXS2 plasmid [84] using the pXS2.Pex13.2 [85] plasmid (gift from Meredith Morris ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were assembled by Gibson assembly using NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, USA).
-
bioRxiv - Synthetic Biology 2022Quote: ... The RNA library was constructed using the NEBNext® Ultra II RNA Library Prep Kit for Illumina (NEB, USA) and sequenced using the Illumina HiSeq X Ten platform.
-
bioRxiv - Neuroscience 2022Quote: ... RNA-seq libraries were generated from total RNA using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB). Paired-end sequencing (2 x 75 base-pair reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified DNA was analysed using ChIP-qPCR and cChIP-seq libraries for both ChIP and input samples were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina following the manufacturer’s guidelines (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... cChIP-seq libraries for both ChIP and input samples were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina following manufacturer’s guidelines (NEB).
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA was extracted and isolated from the retinas using the Monarch Total RNA Miniprep Kit (New England Biolabs) and genomic DNA was removed using RNase-free DNase (Monarch) ...
-
bioRxiv - Genetics 2022Quote: ... and the HiFi reaction performed as per the manufacturer’s protocol using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB). Constructs were verified by a Sacll and Clal digest followed by Sanger sequencing.
-
bioRxiv - Developmental Biology 2022Quote: ... diluted to 20nM and further quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs, MA, USA). Samples were pooled and diluted to 4nM and run on an Illumina Miseq by the Bioinformatics ...
-
bioRxiv - Microbiology 2022Quote: ... Reverse transcription of 10 µl RNA was performed using LunaScript RT Supermix Kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... using NEBNext® Ultra(tm) II FS DNA Library Prep Kit for Illumina (New England Biolabs, Cat. No. E7805), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... DNA libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, USA) and NEBNext Multiplex Oligos for Illumina (New England Biolabs ...
-
bioRxiv - Genomics 2022Quote: ... followed by sequencing library preparation with the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs). Single-end 65-bp reads were sequenced by Illumina HiSeq-2500 system ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... all PCR products from cDNA and gDNA were cloned into the pMiniT 2.0 Vector using the NEB cloning kit (New Englands BioLabs) and sequenced to ensure sequencing of a single DNA molecule.
-
bioRxiv - Microbiology 2022Quote: ... and the fucI PCR product was cloned into the plasmid using the NEBuilder HiFi DNA Assembly Kit (NEB; E5520S), followed by transformation into the E ...
-
bioRxiv - Cancer Biology 2022Quote: The same sets of RNA samples were reverse transcribed using Protoscript II First Strand cDNA Synthesis Kit (NEB #E6560S). cDNA was measured using a QuantStudio 7 Flex Real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... Strand-specific RNA-seq libraries were prepared using NEBNext Ultra II Directional RNA Library Prep Kit (NEB, Ipswich, MA) according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2022Quote: ... RNA sequencing libraries were produced by using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770L). Quantification of the library was performed using a dsDNA HS Assay Kit and Qubit (Molecular Probes ...
-
bioRxiv - Genomics 2022Quote: ... Illumina libraries were constructed using a NEBNext Ultra™ II DNA Library Prep Kit (New England Biolabs, Cat#: E7645). Libraries were quantified using a Bioanalyzer DNA 1000 chip (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... strand-specific RNA-seq libraries were prepared using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB; E7420S) with library amplification specifically modified to accommodate the high AT content of P ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was then transcribed from the NsiI-linearised plasmids with the HiScribe™ T7 ARCA mRNA Kit (NEB E2065S) or HiScribe™ T7 mRNA Kit with CleanCap® Reagent AG (NEB E2080S ...
-
bioRxiv - Plant Biology 2022Quote: ... The NEBNext Ultra II RNA Library Prep with Sample Purification Beads kit (New England BioLabs, Inc., Ipswich, MA, USA) was used for library preparation and libraries were sequenced in two lanes on the 50 bp single-read Illumina HiSeq 4000 platform at the California Institute for Quantitative Biosciences (QB3 ...
-
bioRxiv - Cell Biology 2022Quote: ... and recombined into and SphI digested pRS316-HCM1*SphI using the NEBuilder HiFi DNA assembly kit (New England Biolabs). Plasmids were then transformed into NEB 10-beta Competent E ...
-
bioRxiv - Microbiology 2019Quote: ... The amplicons were then converted into an Illumina-compatible library using NEBNext Ultra II DNA Library Prep Kit (NEB) followed by deep sequencing to determine the incorporation ratio of the two NS variants in progeny viruses ...
-
bioRxiv - Neuroscience 2019Quote: ... Q5® Site-Directed Mutagenesis Kit was used to make mutations (S142A and S211A) in TFEB gene (NEB # E0445S). All Tau constructs used ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA libraries were generated using the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... designed with the NEBaseChanger mutagenesis tool) were used with the NEB Q5 site-directed mutagenesis kit (New England Biolabs).