Labshake search
Citations for New England Biolabs :
601 - 650 of 3671 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... One of each pair was treated with 0.5 μl of calf intestinal phosphatase (CIP) (New England Biolabs #M0290) before the pair were incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotide pairs were resuspended to 100 μM and annealed in a polynucleotide kinase (PNK) mix (New England BioLabs) consisting of 1.5 μL of each oligonucleotide ...
-
bioRxiv - Genetics 2020Quote: ... Pairs of annealed oligos and the digested vector were ligated overnight at 16°C using T4 ligase (NEB). Following transformation ...
-
bioRxiv - Genetics 2020Quote: ... Oligo pairs were separately annealed and all were ligated into digested pCFD3-NS using T4 ligase (NEB, M0202). See Supplemental File 3 for detailed cloning protocols.
-
bioRxiv - Microbiology 2022Quote: ... Each oligonucleotide pair was phosphorylated and annealed using the T4 Polynucleotide Kinase (New England Biolabs, Ipswich, MA, USA). Duplexed oligonucleotides were ligated into BbsI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Benjamin Davies group) between the pair of BsaI site with the NEB Golden Gate Assembly Kit (NEB #E1601). The pROSA-TV2 was designed to contain the 1.4 and 1.2 homology arms of the inserted site and a hygromycin selection cassette that is flanked by a pair of lox sites (loxP) ...
-
bioRxiv - Developmental Biology 2024Quote: ... a pair of single guide RNAs (sgRNAs) were synthesized using the EnGen sgRNA Synthesis Kit (E3322V) from NEB; a total of 1μg of the sgRNA pair along with 20 pmol recombinant Cas9 (EnGen S ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each pair of the synthetized oligos was phosphorylated and annealed using a 10X T4 Ligation Buffer (NEB; # B0202S), at 37°C for 30min and at 95°C for 5 min with a ramp down to 25°C at 6°C/min ...
-
bioRxiv - Biochemistry 2024Quote: ... Distance in the gel was calibrated to base pair length using the λ DNA-HindIII Digest ladder (NEB) with an exponential fit.
-
bioRxiv - Developmental Biology 2020Quote: ... using Luna Universal qPCR Master Mix (NEB), and the data were analyzed by LightCycler software.
-
bioRxiv - Cell Biology 2022Quote: ... or LUNA Universal qPCR Master Mix (NEB) on a 7500 real-time PCR machine (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was performed using LUNA SYBR (NEB) on a Rotorgene (Qiagen) ...
-
bioRxiv - Plant Biology 2021Quote: ... and were quantified by qPCR (E7630, NEB). The 2×150 bp paired-end sequencing with average insert size of 700 bp was performed by Welgene Biotech on an Illumina NovaSeq 6000 platform.
-
bioRxiv - Cancer Biology 2020Quote: ... using Luna qPCR Master Mix (NEB M3003) on an ABI 7500 Real-Time PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... and Luna Universal qPCR Master Mix (NEB) in the CFX Real-Time PCR system (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... Luna® Universal qPCR Master Mix (NEB) was used to quantify mRNA levels for each cell line ...
-
bioRxiv - Physiology 2021Quote: ... LUNA Universal Probe qPCR Mastermix (NEB, #M3004E) and 1,5 μM of primers in a total volume of 5μl were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... using Luna Universal qPCR Master Mix (NEB). Primers for rpl-12(PTC ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the Luna qPCR Master Mix (NEB). Thermocycling was done for 40 cycles in a two-step cycling in accordance with the manufacturer’s instructions and each PCR reaction was performed in triplicate ...
-
bioRxiv - Plant Biology 2023Quote: ... Luna® Universal qPCR Master Mix (NEB) was used for qPCR on an ABI StepOne Plus real-time system (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... Luna Universal qPCR Master mix (NEB, UK) was used for qPCR according to manufacturer’s recommendations (Initial denaturation 95°C ...
-
bioRxiv - Microbiology 2023Quote: ... and Luna Universial qPCR Master Mix (NEB) according to the manual ...
-
bioRxiv - Plant Biology 2023Quote: ... The Luna qPCR Mastermix (NEB, Frankfurt, Germany) was used for amplification on an 7500 Fast Real-Time PCR System (Applied Biosystems™).
-
bioRxiv - Genetics 2024Quote: ... followed by LUNA Universal qPCR kit (NEB). RT-qPCR was performed in a Bio-Rad CFX Opus 96 Real-Time PCR System ...
-
bioRxiv - Genetics 2024Quote: ... followed by LUNA Universal qPCR kit (NEB). RT-qPCR was performed in a Bio-Rad CFX Opus 96 Real-Time PCR System ...
-
bioRxiv - Genetics 2024Quote: ... Luna Universal qPCR Master Mix (NEB, M3003) was used for RT-qPCR reactions and run on CFX384 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the ligation mix was directly used to transform 10-beta competent Escherichia coli cells (NEB), to amplify pSG01 ...
-
bioRxiv - Cell Biology 2020Quote: cDNA was amplified with primers listed in Primers and sequences section of methods with Q5® High-Fidelity DNA Polymerase PCR System (NEB). PCR conditions ...
-
bioRxiv - Genomics 2021Quote: ... Amplification reactions from this cDNA were performed with the 5’ PCR primer and a reverse primer corresponding to the target sequence using LongAmp Taq polymerase (NEB M0287). The PCR products were sequenced and the junction between the ligated oligo revealed the start sites.
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNA was diluted 1/8 in nuclease-free water and used as template for a first touch-down RT-PCR reaction primed with a high-specificity primer (71°C annealing Tm) and a universal reverse primer using Q5 High-Fidelity polymerase (New England Biolabs, USA). The PCR product of this first RT-PCR was then diluted 1/100 in nuclease-free water and used as a template for a semi-nested RT-PCR using a gene-specific primer and the universal reverse primer ...
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Microbiology 2022Quote: ... A second amplification round was performed with a primer bearing a P5 Illumina sequence and P7 indexed Illumina primers (NEB#E7335S). Primer sequences are available on request ...
-
bioRxiv - Bioengineering 2024Quote: ... Target cDNA were then amplified using one primer that annealed specifically to the target RNA and a second primer that annealed specifically to the rcRNA (primers 45/46 for dmd and primers 47/48 for lmna) with Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 35-cycles.
-
bioRxiv - Biophysics 2023Quote: ... we amplified 10 fmol of the original oligo library with unmodified 500 nM primer Z6 and 500 nM primer Z13 with Phusion polymerase (NEB, M0530L). The product was purified following manufacturer’s specifications ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... 1% of the cDNA was used for each qPCR reaction performed with the Luna Universal qPCR Mastermix (NEB M3003) and the PCR primers listed (Supplementary Table1) ...
-
bioRxiv - Genomics 2021Quote: The qPCR reactions were performed with enzymatic selection or control samples using Luna Universal qPCR Master Mix (NEB #M3003S) on a Bio-Rad CFX96 real-time PCR detection system ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (M300, New England Biolabs). The samples were analyzed using a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed in 384 well format with Luna Universal Probe One-Step RT-qPCR Kit (NEB), assaying Fluc (primers oHR711/712 ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR was performed in triplicate with Luna® Universal qPCR SYBR Green Master Mix (New England BioLabs, catalog #M3003L), where 25 ng cDNA was loaded per well ...
-
bioRxiv - Microbiology 2020Quote: ... THUNDERBIRD Probe qPCR Master Mix (Toyobo) for MERS-CoV and Luna Universal Probe One-Step RT-qPCR Kit (NEB) for SARS-CoV-2.
-
bioRxiv - Microbiology 2021Quote: ... 20 μl qPCR reactions were prepared in duplicate as follows: 1x Luna Universal Probe qPCR Master Mix (NEB M3004L), 300 nM of forward and reverse primer ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using Luna® Universal Probe One-Step RT-qPCR kit (E3006L; New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using Luna® Universal Probe One-Step RT-qPCR kit (E3006L; New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2023Quote: ... ddH2O and 2μL of diluted cDNA were used in 10μL qPCR reactions containing the Luna® Universal qPCR Master Mix (NEB) and 0.3μM of gene-specific forward and reverse primer ...
-
bioRxiv - Cell Biology 2024Quote: ... qPCR was performed on the synthesised cDNA using the Luna Universal qPCR Master Mix kit (New England Biolabs, USA). 4 μL of cDNA was added to 1 μL of pre-purchased primers (QuantiTect primers (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... and the RT-qPCR master mix prepared using a Luna Universal One-Step RT-qPCR Kit (New England Biolabs), as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... We performed qPCR on a StepOneTM Real-Time PCR System with the Luna® Universal qPCR Master Mix (NEB). Gene specific primers are outlined in Extended Data Table S4.
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using 10-fold-diluted cDNA and the Luna Universal qPCR Master Mix (New England Biolabs) in the CFX Real-Time PCR system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... All qPCRs were performed using the Luna® Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA) and a Step One Plus qPCR machine (Life Technologies ...