Labshake search
Citations for New England Biolabs :
5251 - 5300 of 6282 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Following the adaptor ligation each sample was mixed with 20 μl of a 2x DpnII Digestion Buffer and 10 units (1 μl) of DpnII restriction enzyme (New England Biolabs) mastermix and were incubated for 3 hours at 37 °C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The resulting library was pooled into 12 separate 60 amino acid long sub-libraries (amino acids 1-60, 61-120 etc.) and combined via Gibson Assembly (NEB) with a linearized p414ADHΔter Hsp90 destination vector ...
-
bioRxiv - Genetics 2021Quote: ... 1 μg of RNA was reverse transcribed in cDNA using random hexamers and M-MuLV reverse transcriptase (New England Biolabs). Quantitative PCRs were assembled with Absolute QPCR ROX Mix (Thermo Scientific ...
-
bioRxiv - Genomics 2021Quote: ... All the other gDNA from the bacteria presented in Table 1 were isolated using the Monarch genomic DNA purification kit (T3010S, New England Biolabs). Xp12 phage genomic DNA was obtained from Peter Weigele and Yian-Jiun Lee at New England Biolabs.
-
bioRxiv - Microbiology 2019Quote: ... The purified DNA was used as template to perform the 2nd step PCR using NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (New England Biolabs), followed by Bioanalyzer analysis and gel purification ...
-
bioRxiv - Microbiology 2019Quote: In vitro transcribed 3X-FLAG tagged manY transcripts – wild-type or Δenh (1 pmol) were translated in vitro using the PURExpress translation kit (NEB). Translation reactions were stopped by adding Laemmli sample buffer (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... These gBlocks were assembled into an expression vector on the pETDuet-1 plasmid backbone with the help of the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). First ...
-
bioRxiv - Developmental Biology 2021Quote: ... A small multiple cloning site was added before the start codon of exon 1 by site directed mutagenesis (Q5 SDM Kit, New England Biolabs) using the primers rab11a-MCS-SDM-forward 5’-tactagttccATGGGGACACGAGACGAC-3’ and rab11a-MCS-SDM-reverse 5’-agaccggtaggCTCGATCAAAACAAAAGCGC-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... Annealed oligos were diluted to 1:200 and were used as inserts for ligating to digested lentiCRISPR v2 (50 ng) by T4 DNA Ligase (NEB) in 10X T4 DNA Ligase buffer (NEB) ...
-
bioRxiv - Physiology 2020Quote: We prepared RNAseq libraries from 1 μg of total RNA with the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB) according to the manufacturer protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Supplementary Data 1) P1 adapters (200 nM) containing unique 12 bp barcodes were ligated by incubation with T4 ligase (NEB) at room temperature for 30 min and the reaction was terminated by 20 min at 65°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3’ RNA adaptor (/ 5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 40 μl 50% PEG 8000 for 1 hour at room temperature then incubated overnight at 25°C in 100 μl 1x T4 RNA ligase buffer (NEB) containing 40 μl 50% PEG 8000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PEARL extracts from cultured cells were treated with either DNase I (1 unit per every 8 μL of PEARL extract, New England BioLabs) or with RNase A (0.1 mg per every 8 μL of PEARL extract ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μL RNA was mixed with 2 μL of 100 μM PvG748-SBS12-RT random hexamer primer (IDT) and 1 μL of 10 mM dNTP mix (NEB). The sample was incubated for 3 min at 65 °C and transferred to ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... 13.5 μL digestion reaction product was combined with 1.5 μL second-strand synthesis (SSS) buffer and 1 μL of SSS enzyme mix from the NEBNext mRNA Second Strand Synthesis Module (NEB) and incubated at 16 °C for 2.5 h ...
-
bioRxiv - Molecular Biology 2020Quote: In vitro cleavage assay with the purified AsCas12a and SpCas9 nucleases was carried out in a volume of 30 µL in 1× NEB2.1 buffer (New England Biolabs Inc.). The standard reaction containing 10 nM of PCR-obtained DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... Supplementary Table 7) were ligated to 5 μg of total RNA using 10 U of T4 ssRNA Ligase 1 (NEB) in a final volume of 50 μl for 1 h at 37°C and 1X T4 of RNA Ligase Reaction Buffer (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a final volume of 50 μl for 1 h at 37°C and 1X T4 of RNA Ligase Reaction Buffer (NEB, 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl of Universal nuclease (Pierce; 125U/L of culture) and 10 μl of DNaseI (NEB; 20U/L of culture) were added and the mixture allowed to incubate for 10 min at RT ...
-
bioRxiv - Molecular Biology 2019Quote: ... The HIS-SUMO-BAHEPR-1 fusion and HIS-SUMO tag constructs were expressed in Escherichia coli BL21 DE3 cells (New England BioLabs). Both HIS-SUMO-BAHEPR-1 and HIS-SUMO cultures were initially grown in 4 liters of LB media at 37 °C at 200 RPM until cultures reached an optical density of ∼ 1.0 at 600 nm and then cultures were pelleted ...
-
bioRxiv - Cell Biology 2022Quote: SDS-PAGE and Western blot analysis were performed as previously described (Alpy et al, 2005) using the following antibodies: rabbit anti-GFP (1:2000; TP401, Torrey Pine Biolabs), rabbit anti-MOSPD2 (1:250 ...
-
bioRxiv - Genomics 2019Quote: ... DNA fragments were circularized in a dilute mixture of 1ng/μL DNA in T4 DNA ligase buffer with 1 cohesive end unit/μL T4 DNA ligase (New England Biolabs) for 16 hours at 16ºC ...
-
bioRxiv - Genomics 2019Quote: ... Beads were washed twice with SPRI wash buffer and resuspended in 200 ul of intra-aggragete mix (171 ul water, 1 ul 100 mM ATP, 20 ul 10x NEB T4 DNA Ligase Buffer ...
-
bioRxiv - Genomics 2020Quote: ... PCR reactions were performed in 50 μl volumes with 1 ng pFA-MNase plasmid and the Q5 high fidelity polymerase (New England Biolabs). PCR thermocycling was executed as following ...
-
bioRxiv - Genomics 2020Quote: ... Irradiated and control DNA was either loaded directly on a 1% agarose gel or incubated with T4 endonuclease V (New England Biolabs) for 30 minutes at 37°C and subsequently analyzed by agarose gel electrophoresis using a 1% agarose gel.
-
bioRxiv - Genetics 2019Quote: ... 2011) (Table S2-S3) were ligated to the digested DNA with 1 U of T4 DNA ligase (New England Biolabs) in 50 μl of reaction volume at 16°C for 5 h and inactivated at 65°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... were used in combination with mutation primers (Table 1) to generate overlapped PCR fragments (Phusion High-Fidelity DNA Polymerase, NEB), with disrupted RNA structure at each selected PAR-CL sites ...
-
bioRxiv - Genomics 2019Quote: ... we digested each sample with the restriction enzymes SphI-HF and MluCI for 1 hour at 37°C (New England Biolabs). These enzymes were chosen because they are insensitive to DNA methylation (and therefore will not show biased template enrichment ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Transcriptional units were amplified directly from the golden gate mixture using 1 µL of reaction mixture as template in 50 µL Q5 Hot-Start Master Mix reactions (NEB). PCR reactions were performed according to manufacturer’s instructions and cleaned up using clean and concentrate kits (D4004-Zymo Research) ...
-
bioRxiv - Molecular Biology 2019Quote: ... all reactions using capped 25mer RNA substrates were terminated by the addition of 1 volume of 2X RNA loading dye (NEB). The reactions using the m7GpppA dinucleotide cap analog were terminated with the addition of phenol/chloroform.
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutagenesis was carried out by PCR amplification of the starting plasmid with forward and reverse mutagenesis primers containing the desired mutation (Table 1) followed by DpnI (NEB) treatment ...
-
bioRxiv - Microbiology 2019Quote: ... the 11.4 kb fragments of GPV- or HIV- GPP were joined with their cognate 304 bp zip coded partial U3 inserts via Gibson Assembly in a molar ratio of 1:5 per reaction using HiFi DNA assembly mix (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Molecular Biology 2019Quote: Messenger RNA (mRNA) was enriched from 1 μg of total RNA by Poly(A) mRNA Magnetic Isolation Module (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A PCR reaction adding a T7 promoter/terminator pair on each aptamer (see Table 1) was carried out using Q5 High-Fidelity DNA Polymerase (New England Biolabs Inc.(NEB) #M0491 ...
-
bioRxiv - Genomics 2019Quote: ... diluted to 100 ng/µL and blunted using 1 U/µg mung bean nuclease under the appropriate buffer conditions (New England Biolabs). The DNA fragments of 150–200 bp length were gel-extracted on 3% NuSieve 3:1 Agarose (Lonza) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the bar-1 locus was genotyped for successful co-conversion by PCR amplification with OneTaq polymerase (New England Biolabs) using primers that annealed to the genomic DNA surrounding the insertion point ...
-
bioRxiv - Genomics 2019Quote: ... 20 U RNasin Ribonuclease inhibitor and 1× protease inhibitor mix) and further treated with 100 U of DNase I (NEB) for 20 min on ice ...
-
bioRxiv - Genomics 2019Quote: ... The supernatant was carefully removed and nuclei were resuspended in 100 μl of DNase digestion buffer (1× DNase buffer (NEB), 25 µM α-amanitin ...
-
bioRxiv - Genomics 2020Quote: Cas9 protein and transcribed sgRNA were incubated for 10 min at room temperature in reaction buffer containing 1× NEB buffer 3.1 (NEB Biolabs) supplemented with 1 mM DTT ...
-
bioRxiv - Genetics 2019Quote: ... The reaction was incubated at 50°C for 1 hour and the remaining RNA was degraded by RNase H (NEB) and RNase A (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2019Quote: ... universal adaptors were ligated to the A-tailed DNA fragments at room temperature for 1 h with T4 DNA ligase (New England Biolabs) and amplified with Illumina barcoded primers using KAPA SYBR FAST qPCR Master Mix for 5∼12 PCR cycles to obtain enough DNA for sequencing ...
-
bioRxiv - Bioengineering 2019Quote: ... pneumoniae chromosomes are incubated overnight at 37°C in presence of 1 µL of Cas9 Nuclease from Streptococcus pyogenes (M0386T, NEB) and 21 µg of gRNA transcripts produced by in vitro transcription of oligonucleotides (HiScribeTM T7 High Yield RNA Synthesis kit from NEB) ...
-
bioRxiv - Genomics 2019Quote: ... solution was diluted 1:20 and 5 μL used in a standard 50 μL PCR reaction using Q5 enzyme (NEB). PCR products were Sanger sequenced and analyzed using SnapGene to identify SNP corrected clones (7/192) ...
-
bioRxiv - Biophysics 2019Quote: ... Both the 2 kb spacer and 1.5 kb biotin handle DNA were ligated to 5’-CGGT 1 µm polystyrene oligo beads overnight at 16 °C using T4 DNA ligase (NEB). The ligated beads were first washed with TE + 0.5 M KCl + 20 µg/mL β-casein ...
-
bioRxiv - Cell Biology 2019Quote: ... Genomic regions of about 1 kb were amplified from wild-type genomic lysates using Q5 Hot Start high-fidelity polymerase (New England Biolabs) with the following primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... a ~200 bp amplicon was generated from 1×106 template molecules by PCR in 22 cycles using Phusion polymerase (NEB), purified with the QIAquick gel extraction kit ...