Labshake search
Citations for New England Biolabs :
5051 - 5100 of 6282 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized from 0.5-1 µg of RNA per sample using Protoscript II RT and Random Primer Mix (New England Biolabs). qPCR reactions were performed on cDNA using iQ SYBR Green supermix (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... 107 epimastigotes were electroporated with 2.5 µg of pTRIX2-GFP plasmid (Fig 1 A) linearized with AscI and SacI (NEB). The plasmid had been derived from pTRIX-REh9 [28] ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized from 1 μg total RNA using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB) with oligo-dT priming according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... The coupling reaction was performed at 25 °C for 1 h and followed by addition of 0.2 unit/mL apyrase (New England Biolabs). After additional 1 h at 25 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were dialyzed with water on silica membranes (0.025 μm pores) for 1 hour before transformed into DH10β cells (New England Biolabs). Library sizes of at least 100,000 colony-forming units (CFU ...
-
bioRxiv - Biochemistry 2022Quote: Native 3’ end extension assays experiments where set-up as describe in the D-loop assays with the exception that dNTP’s (1 mM) and Klenow (exo-)(NEB) were added after 10 minutes of D-loop formation ...
-
bioRxiv - Genetics 2022Quote: ... The human codon-optimized Cas9 gene (Supplementary file 1) was synthesized by HuaGene (Shanghai, China) and cloned into the Nme2Cas9_AAV backbone by the NEBuilder assembly tool (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 25mM Tris-HCl) and then lysed using TD/1% NP-40/RVC (Ribonucleoside-Vanadyl Complex, NEB, Cat. No. S1402) in the presence of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... standard PCR reactions were performed on 1 ul of cDNA using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and each of the variant PCR primer pairs independently ...
-
bioRxiv - Plant Biology 2021Quote: ... We sent 300ng of DNA in 20μl to LGC Genomics GmbH (Germany) where genomic DNA were digested with 1 Unit MslI (NEB) in 1 times NEB4 buffer in 30 μl volume for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were treated for 15 minutes at 37°C with 1 μM BG-SS-649 (Marzook et al., 2021) (a gift from Dr Ivan Corrêa Jr, New England Biolabs) in complete media to reversibly label surface SNAP-tagged receptor populations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two separate 8-µl aliquots of beads derived from each strain were treated with 1 µl lambda phosphatase (NEB) in 10 µl reactions containing ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4(wACBD5_FFAT)/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Microbiology 2021Quote: ... First strand cDNA synthesis was done by incubating 1 μg total RNA with 2.5 mM Oligo dT(18) and 0.5 mM dNTP mix (NEB, N0447L) for 5 min at 70°C before placing on ice for 2 min ...
-
bioRxiv - Immunology 2020Quote: ... Amplicon DNA was denatured and reannealed in a thermocycler prior to cleaving by T7 Endonuclease 1 (New England Biolabs) at 37°C in a 30min reaction ...
-
bioRxiv - Biochemistry 2020Quote: Every single stranded oligonucleotide (1 nmol) was 5’-end-phosphorylated with 40U of T4 Polynucleotide kinase (New England Biolabs) by incubation at 37°C in 1x T4 DNA Ligase Reaction Buffer.
-
bioRxiv - Cancer Biology 2021Quote: ... 25mM Tris-HCl) and then lysed using TD/1% NP-40/RVC (Ribonucleoside-Vanadyl Complex, NEB, Cat. No. S1402) in the presence of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher ...
-
bioRxiv - Neuroscience 2022Quote: ... so the bead-bound proteins were dephosphorylated in wash buffer containing 1:50 Lambda Protein Phosphatase (New England Biolabs) and 1 mM MnCl2 to make the phosphosites more accessible for a kinase assay ...
-
bioRxiv - Immunology 2022Quote: ... was mixed with backbone vector at 1:2.5 mass ratio in Golden Gate reaction using BsmBI restriction endonuclease (NEB) and T4 DNA ligase (NEB) ...
-
bioRxiv - Neuroscience 2019Quote: ... PBT was removed and samples were incubated in SNAP substrate diluted in PBT (SNAP-Surface649, NEB S9159S; 1:1000) for 1 hour at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... Samples were ligated overnight at 16ºC with a DNA / RNA oligo (rP5 _ RND: TTTCCCTACACGACGCTCTTCCGATrCrUrNrNrNrNrNrNrNrN) using T4 RNA ligase 1 (New England Biolabs). RNA integrity after ligation was assayed by agarose gel electrophoresis and poly(A)RNA was purigied using oligo dT magnetic beads ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were collected by centrifuging and resuspended with 100 µL of 0.3% SDS in 1×NEBuffer 2.1(NEB, B7002S) with following shaking at 37°C for 30 minutes at 900 rpm ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 50 ul PCR reactions were set up with approximately 1 ug cDNA and Phusion High-Fidelity DNA Polymerase (NEB) was used ...
-
bioRxiv - Bioengineering 2019Quote: ... were injected over the flow cell 1 in Neb2.1 buffer 1x and Cut Smart buffer 1x (New England BioLabs) respectively ...
-
bioRxiv - Biochemistry 2020Quote: ... Remodeling reactions were started by adding 10 μL SGD chromatin corresponding to ~ 1 μg DNA assembled into nucleosomes and terminated by adding 0.8 Units apyrase (NEB) followed by incubation at 30 °C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 μl 5x PNK pH 6.5 buffer [350 mM Tris-HCl pH 6.5, 50 mM MgCl2, 5 mM DTT], 1 μl PNK enzyme [NEB] ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a total volume of 20 µL containing 10 U of T4 RNA Ligase 1 (NEB, cat n° M0204L), 1X T4 RNA ligase buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... the plug was incubated in 160 μl of 1× NEBuffer 3.1 buffer containing 160 units of Bgl II (New England BIolabs) overnight at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... Precipitated DNA was incubated with adaptors at room temperature for 1 hr with T4 DNA ligase (New England Biolabs) and amplified with Illumina primers.
-
bioRxiv - Genomics 2020Quote: ... Precipitated DNA was incubated with adaptors at room temperature for 1 h with T4 DNA ligase (New England Biolabs) and amplified with Illumina primers.
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Genomics 2021Quote: ... Following this, 2μL Exonuclease 1 (20U/μL, Enzymatics X8010L) and 1μL Shrimp Alkaline Phosphatase (rSAP) (1U/μL, NEB M0371L) was added to each reaction followed by vortexing and incubation in a thermocycler at 37°C for 30min followed by 4°C forever.
-
bioRxiv - Genomics 2019Quote: ... was used to digest genomic DNA (0.5 – 1 μg) overnight in a total reaction volume of 200 μl (NEB). MmeI was inactivated by incubation at 65°C for 20 min ...
-
bioRxiv - Immunology 2019Quote: ... 2.4 mg sequence verified vector was digested at 2 μg/μL in NEB 3.1 buffer with 1200 U Nt.BspQI for 1 h at 50 °C followed by addition of 2400 U XhoI (NEB) and incubation for 1 h at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... DNA was treated with RNase A for 1 hr at 37°C and Proteinase K (New England Biolabs, 8107) for 1 hr at 55°C ...
-
bioRxiv - Genetics 2020Quote: ... PCR analysis was carried out with different primer sets (Supplementary Table 1, Fig. 2B) using Phusion High-Fidelity DNA Polymerase following the manufacturer’s instructions (New England Biolabs).
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR reactions contained 10 ng of template DNA and 1X 5PRIME HotMasterMix (Quanta Biosciences) as well as 0.4 mg ml-1 BSA (NEB) and 0.4 μM of each primer ...
-
bioRxiv - Biochemistry 2021Quote: ... Both fragments were run on a 1% agarose gel and purified using a Monarch DNA Gel Extraction kit (NEB). The fragments were then joined using the NEBuilder HiFi DNA Assembly protocol (NEB).
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μg of each sgRNA and 60 pmol Cas9-NLS protein (EnGen® Spy Cas9 NLS, NEB, M0646 M) with the Lonza 4D X-unit ...
-
bioRxiv - Synthetic Biology 2021Quote: Sub-parts (modules, Supplemental Table 1) were amplified via high-fidelity polymerase chain reaction (PCR) (New England Biolabs #M0491S) using dsDNA templates and ssDNA primers listed in Supplemental Table 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μg of total RNA was used in cDNA synthesis using ProtoScript II Reverse Transcription kit (NEB, Cat # e6560) as per manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Five µl of the hybridization product was combined with 1 µl of 20 µM Cas9 protein (New England Biolabs) at room temperaturefor 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: RNase III assay: 1 μg double-stranded (ds) RNA substrates were digested with either ShortCut® RNase III (NEB) or RNase III (6xHis ...
-
bioRxiv - Molecular Biology 2021Quote: ... Each amplification template containing appropriate copy number of the gene was added into the master mix containing 1 μL of Bst 3.0 DNA polymerase (Cat. No. M0374L, NEB), 2.5 μL of 10 × isothermal amplification buffer ...
-
bioRxiv - Immunology 2021Quote: ... except after the Ni-NTA step it was concentrated (1 mg/ml in 0.2 ml) and shaved with endoglycosidase D (10 μl, 100 unit) (New England BioLabs) for 16 hrs at 4°C prior to gel filtration ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Molecular Biology 2021Quote: ... the beads were incubated with 1 µl CK2 enzyme and 1X CK2 reaction buffer (NEB Inc; catalog no. P6010S) supplemented with 200 µM ATP and 30 mM MgCl2 and rotated for 1 h at 30ºC ...
-
bioRxiv - Immunology 2022Quote: ... Glycopeptides from the other replicate was then deglycosylated by incubation with 50 μL of 50 mM Tris-HCl (pH=7.5) with 1 unit per microliter of PGNase F (New England Biolabs) over night at 37 °C ...