Labshake search
Citations for New England Biolabs :
5201 - 5250 of 6282 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: 3’ dephosphorylation was performed by incubating fragments with 10 U/uL T4 Polynucleotide Kinase (New England Biolabs M0201S) in the supplied buffer (NEB B0201S ...
-
bioRxiv - Neuroscience 2021Quote: NFIB 3’ UTR and 5’ UTR HP forming regions were in vitro transcribed using T7 transcriptase (NEB, E2040) and purified with Trizol extraction (described in RT-qPCR paragraph) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... This fragment was generated by a standard 3-step PCR protocol using Phusion DNA polymerase (New England Biolabs) and then cloned into the XbaI and HindIII sites of pEX18A (Prentki and Krisch ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fragmented RNA was then subjected to RNA 3’ linker ligation using T4 RNA Ligase I (New England Biolabs) and reverse transcription using a primer complementary to the linker sequence and SuperScript III (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Bioengineering 2020Quote: ... and the 3’ extension were ligated together into the digested vector using Quick Ligase or T4 Ligase (NEB) to generate the complete pegRNA plasmid ...
-
bioRxiv - Neuroscience 2019Quote: ... Ten microliters of PCR products were digested with Nsi1 (3 hours with 5 units of Nsi1 enzyme (NEB)) and then ...
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR was carried out using the primers in Supplementary Table 3 and Luna Universal qPCR Master Mix (NEB) in a BioRad iCycler in technical triplicates for each biological replicate ...
-
bioRxiv - Immunology 2021Quote: ... we modified the plasmid using primers EpMap_1 and EpMap_2 along with ssODN EpMap1_ssODN (Extended Data Table 3) using the NEBuilder Mastermix (NEB, E2621S) following the manufacturer’s instructions in order to create hairpin-free overlap regions that could be used for homology-based library cloning ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5µL of 10µM MBTUni-12 primer + 2.5µL of 10µM MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) + 10µL 5x HF Phusion Buffer + 1µL 10mM dNTPs mix (NEB #N0447S) + 0.5µL Phusion Polymerase + 28.5µL of Nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2020Quote: ... was added at 3’end of RA5) was ligated to RNA using T4 RNA ligase (New England Biolabs) at 25°C for 6 hr and 22°C for 6 hr ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Microbiology 2019Quote: The DNA oligo i116 that served as a 3’ adapter was adenylated using 5’ DNA Adenylation Kit (NEB), purified by ethanol precipitation as above and diluted to 10 μM with nuclease-free water.
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... and cloned between 300 bp of PCR amplified DNA fragments of the LdBPK_250018100.1 5’ and 3’ UTR using NEBuilder (NEB) inside pUC19 for construct amplification in E ...
-
bioRxiv - Molecular Biology 2021Quote: ... Homology arms and exon 3 of the murine Akr1b3 locus were amplified with Q5 polymerase (New England Biolabs) using genomic DNA from mouse R1 ES cells (23) ...
-
bioRxiv - Systems Biology 2021Quote: ... Adaptors for Illumina sequencing were added via PCR amplification using Nspacer_barseq_pHIMAR (Wetmore et al., 2015) and NEBNext Index 3 Primer for Illumina (New England Biolabs). Cycle conditions were 30 seconds 98°C followed by 4 cycles (15 seconds 98°C ...
-
bioRxiv - Genomics 2020Quote: ... The sample was then combined with 3’ RNA Ligase Master Mix (8μL 50% PEG 8000, 2μL 10x T4 RNA Ligase Buffer (B0216L, NEB), 1.5μL nuclease free water ...
-
bioRxiv - Molecular Biology 2021Quote: ... R: 5’-ccgggaaaaactgaaaaaccattggcacgacaggtttcccgac-3’ from the pKAM555 vector) was inserted at the ClaI site using HiFi assembly (NEB). For the intTEL0 strain creation the pUC19LG plasmid (lacking the PstI(blunted)-BclI fragment of the HARS36 sequence ...
-
bioRxiv - Neuroscience 2021Quote: ... Phosphatase treated samples were enzymatically treated for 3 n at 37°C shaking (1.25 μl 10 μM MnCl2, 1.25 μl 20X NEB buffer ...
-
bioRxiv - Genomics 2021Quote: ... Resulting supercoiled plasmid is linearized at the 3’ end of the PolyA tail using BamHI-HF (NEB R3136S), and checked for reaction completion by running on agarose gel ...
-
bioRxiv - Genetics 2020Quote: ... the mutant Tile 3 was subcloned into the full length AttB-KCNH2-HA:IRES:mCherry by restriction digest with BglII and NdeI (NEB) and ligation with T4 ligase (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: Ligation workups from the previous step were supplemented with 3 μL of 6X purple gel loading dye (NEB), heat denatured at 85 °C for 1 min ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the previously constructed genome-integrating vector pCS75 (25) (Supplementary Table 3) was cleaved with PmeI and EagI (NEB), the resulting fragments were separated on a 0.8% agarose gel ...
-
bioRxiv - Genetics 2022Quote: ... The second strand cDNA synthesis was performed using Klenow fragment 3’-5’ exo (New England Biolabs Inc, USA), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... 3.) Library preparation was performed using the NEBNext Ultra II library preparation kit for Illumina (New England Biolabs) and 4. ...
-
bioRxiv - Microbiology 2024Quote: ... 1.25 µL native ligation barcode (ONT SQK-NBD114-96) and 3 µL Blunt/TA Ligase Master Mix (NEB). The reaction was mixed by pipetting ...
-
bioRxiv - Cancer Biology 2024Quote: ... A single adenine base was added to fragment ends by Klenow fragment (3′ to 5′ exo minus; NEB), followed by ligation of Illumina adaptors (Quick ligase ...
-
bioRxiv - Cell Biology 2023Quote: Ifnb1 mRNA 3’ UTR (NM_002176.4) was synthesized using the HiScribe T7 High Yield RNA synthesis kit (NEB, E2040S) through in vitro transcription ...
-
bioRxiv - Genomics 2023Quote: ... nick ligation was then performed in a 30 µL reaction with 3 µL of 10x rCutSmart Buffer (NEB), 1.56 µL of 500 µM β-Nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 3’ A-addition and adapter ligation using a custom reagent formulation (New England BioLabs, E6000B-10). Libraries were pooled in equal molar amounts and were sequenced using an Illumina HiSeqX platform (Ilumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... At least 3 sgRNAs per gene were cloned using ssDNAs oligoes (IDT) and NEBuilder HiFi DNA Assembly (NEB) into modified backbone ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 µl of 100 mM dATP solution and 2.5 µl of Klenow Fragment (3′->5′ exo-) (NEB, #M0212L) were added to the mixture ...
-
bioRxiv - Microbiology 2023Quote: ... The 3′ ends of purified RNA were dephosphorylated with the addition of T4 PNK enzyme (New England Biolabs) and 10 mM ATP was added to phosphorylate the 5’ ends of the RPF (ribosome protected fragments) ...
-
bioRxiv - Microbiology 2023Quote: Purified vigR 3’ UTR amplified from JKD6008 was in vitro transcribed (IVT) using HiScribe T7 RNA polymerase (NEB). RNA products were DNase I treated (NEB ...
-
bioRxiv - Genomics 2023Quote: ... CBS 112042+ and CBS 124.78+ were sequenced on R9.4.1 flowcells using the LSK108 kit with 3 μg DNA as input for the end prep reaction (NEB ULTRA-II EP ...
-
bioRxiv - Molecular Biology 2024Quote: ... using ETAA1 DBR R1 RT-PCR primer 5′-AAGTTCTTCTTCTTGACTTTGTGTT-3′ and treated with RNaseH (New England Biolabs, M0297S). 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... 3 μL of a ligation mixture containing 0.01 U of Bst 2.0 DNA polymerase (NEB, Ipswich, MA, USA), 0.5 U of SplintR ligase (NEB ...
-
bioRxiv - Neuroscience 2024Quote: After washed with 0.1 3 SSC buffer (Thermo, AM9770) supplemented with 0.05 U/ml RNase inhibitor (NEB, M0314L), tissue sections placed on the chip were permeabilized using 0.1% pepsin (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... The entire alh-6 genomic sequence (ATG to stop) was amplified by PCR and cloned in a linearized pMiniT 2.0 vector (NEB PCR Cloning Kit, Cat. #E1202S). Plasmid DNA was purified using the Zymo Research Zyppy Plasmid Miniprep kit (Cat ...
-
bioRxiv - Plant Biology 2020Quote: ... and cDNA was synthesized from 1 µg of total RNA using ProtoScriptR II Reverse Transcriptase (New England BioLabs, MA, USA) in 20 µl reaction with oligo (dT ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and +1 sites of the promoters controlling transcription of both RNAs were used to amplify the standard pUC19 plasmid (NEB). After PCR amplification samples were digested with DpnI (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Ni-NTA resin elute was immediately diluted with PBS containing 1 mM EDTA (PBS-E) and incubated with amylose resin (New England Biolabs) for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was then diluted 1:10 with nuclease free water prior to adding 1 µL to a PCR reaction containing 500 uM forward and reverse primer and 1X Q5 Master Mix (NEB). Reactions were cycled 35 times with annealing temperatures calculated by NEB Tm calculator prior to loading on 2% agarose gels ...
-
bioRxiv - Molecular Biology 2020Quote: ... 40 μg/ml phenylmethylsulfonyl fluoride and protease inhibitor) and resuspended again in 1 ml MNase digestion buffer with 1,250 Units MNase (NEB Biolabs). Chromatin-MNase mix was incubated at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Endogenous mRNA was removed by treating the pooled fractions (200 μL) with 2.4 μL CaCl2 (40 mM stock) and 1 μL micrococcal nuclease (New England BioLabs M0247S) at room temperature for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA coding region corresponding to RDGBPITPd-FFAT (amino acids 1-472) was subcloned into pUAST-attB by using the restriction enzymes NotI and XbaI (NEB). Similarly ...
-
bioRxiv - Genetics 2021Quote: ... ChIP-Seq libraries were prepared from 1-40 ng of DNA using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Adaptors were diluted 10-fold prior to ligation ...