Labshake search
Citations for New England Biolabs :
5301 - 5350 of 6282 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... The region harboring the randomized hexamer and flanking constant tags was amplified from 1 µg ssDNA for 5 cycles using the Q5 Hot Start High-Fidelity PCR Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Genetics 2021Quote: ... Ligation was performed in a total volume of 20 μl by the addition of 1 μl T4 DNA Ligase (400 Units, NEB) in 1X T4 DNA Ligase buffer (NEB ...
-
bioRxiv - Genomics 2021Quote: ... and on the other side a primer that targets a region introduced through the library preparation called “Read 1” (18 cycles using NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs)) ...
-
bioRxiv - Genomics 2019Quote: ... 1 to 10 ng of gel-purified retrozyme RNA were ligated using RtcB ligase in its corresponding buffer for 1 h at 37 °C (New England Biolabs). Best results for self-ligation assays were obtained with 1 to 10 ng of gel-purified retrozyme RNA in 50 mM Tris–HCl ...
-
bioRxiv - Immunology 2021Quote: ... EtAMA1 and EtIMP1 coding sequences (codon-optimised for yeast) were excised from the constructs generated in study 1 by restriction digest with BamHI and NotI (New England Biolabs). Cloning of the untagged EtAMA1 and EtIMP1 coding sequences into pYD1 was then performed as described for study 1.
-
bioRxiv - Cell Biology 2021Quote: One plug per sample was melted at 68°C in 1 mL 100 mM MES buffer pH 6.5 prior to addition of β-agarase (New England Biolabs) and incubation overnight at 42°C ...
-
bioRxiv - Microbiology 2021Quote: ... Primers listed in supplemental table 1 were annealed and ligated into the digested plasmid using T4 ligase (New England Biolabs). For the generation of pGRA1.GFP.GRA2.DHFR ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’ homologous arm was amplified through overlap extension: Fragment 1 was amplified from y,sc,v genomic DNA using Q5 High-Fidelity DNA Polymerase (New England BioLabs) with primers- clk-5’-Fragment1-F and clk-5’-Fragment1-R (listed in Supplementary Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... were reconstituted by mixing 1 µl of 100 µM stocks of the forward and reverse strands for each guide with 1 µl of 10x ligation buffer (NEB), 0.5 µl T4 polynucleotide kinase (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were resuspended in 1 ml of iCLIP lysis buffer B (same as buffer A but with 1% v/v NP-40 and 11 μl of Murine RNase inhibitor (NEB) per 1 ml ...
-
bioRxiv - Systems Biology 2020Quote: ... We neutralized the tagmentation activity of Enzyme 1 by immediately cleaning the reaction with the Monarch PCR & DNA Cleanup Kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... a 2.4-kb PCR fragment spanning Rv3377c-Rv3378c was generated using primers BamHI-Rv3377c-Rv3378c-F and HindIII-Rv3377c-Rv3378c-R (Sup. Table 1) using high-fidelity Phusion DNA polymerase (New England Biolabs). The fragment was subsequently digested with BamHI and HindIII (all restriction enzymes from New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... The hygR insert and the inverse PCR product of the pEX18Ap backbone were mixed at a 5:1 ratio and ligated for 30 minutes at 50°C with New England Biolabs (NEB) Gibson Assembly ® Cloning Kit to create pEX18HygB ...
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...
-
bioRxiv - Plant Biology 2021Quote: ... Supplementary Table 1) were hybridized by slow cooling from 95-25°C and then phosphorylated using T4 Polynucleotide Kinase (NEB). The digested plasmid and the hybridized oligonucleotides were ligated using T4 Ligase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... The gene fragment was amplified from approximately 30ng of DNA in each sample (primers in Supplementary Table 1) using a high-fidelity polymerase (NEB Q5, New England Biolabs)[27] and confirmed by 1% agarose gel electrophoresis ...
-
bioRxiv - Molecular Biology 2021Quote: ... were cloned into pEGFP-C2 or pGEX5X.1 vector and transformed into NEB 10-beta competent E.Coli (New England Biolabs # C3019H). Mutagenesis to generate PARP1 ...
-
bioRxiv - Cell Biology 2020Quote: ... the CometChip was washed three times with PBS before being incubated for 1 h at RT in FPG (M0240S New England Biolabs) diluted 1:104 in PBS ...
-
bioRxiv - Biophysics 2020Quote: ... The lysate was cleared from cell debris by centrifugation at 50000 g for 1 hour followed by incubation with Amylose resin (NEB) for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... Then 50-fold molar excess of oligo 2 was added to the mixture along with an additional 1 µL of T4 DNA ligase and T4 DNA ligase buffer (NEB) with ATP adjusting for the change in volume and allowed to incubate at room temperature for 30 minutes ...
-
bioRxiv - Genomics 2022Quote: ... The TdT reation was prepared using 4 μL of the resulting elutant and 5 μL of ice-cold TdT mix (standard Quartz-seq2 condition: 1× Thermopol buffer [New England Biolabs] ...
-
bioRxiv - Biochemistry 2022Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 °C for 5 min and 60 °C for 5 min ...
-
bioRxiv - Immunology 2022Quote: ... The plasmid at 10-25 ng/μl concentration together with 1 μl I-SceI meganuclease and NEB buffer (NewEngland BioLabs) were co-injected into the blastomere at one-cell stage embryos ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The reactions were done using 150 ng of each part of the TU and either used the same recipe as level 1 or by using the NEB Golden Gate Assembly Mix (New England Biolabs) according to the manufacturer’s instruction ...
-
bioRxiv - Physiology 2022Quote: ... 1 L of diluted extracts were incubated with 9 ml of packed amylose resin (catalog no. E8021S, New England Biolabs) and incubated at 4°C for 2h with gentle rotation ...
-
bioRxiv - Biochemistry 2022Quote: ... a ~1-1.5Kb fragment that included guide-RNA target sites was PCR amplified using Q5 High-Fidelity DNA Polymerase (NEB; M0491). Primers were designed using the NCBI Primer Blast tool and are documented in the key resources table ...
-
bioRxiv - Biochemistry 2022Quote: ... accordingly to manufacturer’s instructions and 1 μg of RNA was reverse-transcribed into cDNA using M-MuLV reverse transcriptase (New England Biolabs) and random hexamers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and T492 were created through PCR mutagenesis of an intron-less version of pHC329 using the oligonucleotides (#1-14) and HiFi assembly (NEB) (Fig ...
-
bioRxiv - Biophysics 2022Quote: ... The DNA fragment was amplified by PCR by inserting a C-terminal 6x His tag and cloned into the pETDUET-1 vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Microbiology 2022Quote: ... Individual fragments were assembled by Gibson assembly at 50°C for 1 h in a total reaction volume of 20 µl (NEBuilder HiFi DNA Assembly Cloning Kit, New England Biolabs), thereby adding 6x His-tag coding sequences to the 3’ end of ply007 ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were performed at 80 °C for 60 minutes and terminated by the addition of 1 μL of Proteinase K (NEB). Cleavage fragments from pre-linearized substrates were purified using paramagnetic beads and quantified and analyzed as described above ...
-
bioRxiv - Biochemistry 2022Quote: ... with 0.1 pmol of ~60bp ssDNA oligo (either oBK9102 or oBK9104) with 10 μL NEBuilder HiFi DNA Assembly Master Mix (NEB) in a final volume of 20 μL ...
-
bioRxiv - Microbiology 2022Quote: ... and a subpart of it encoding specifically the PAS domain (amino acids 1-138) the corresponding coding sequence was amplified by PCR using the Phusion DNA polymerase (New England Biolabs) and cloned between the NdeI and BamHI sites ...
-
bioRxiv - Biophysics 2022Quote: ... The SETD3 V266D mutant was introduced into EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) by Gibson Assembly (New England Biolabs). The SETD3 V266D construct was then used as a template to sequentially incorporate Q257A and Y288P mutations by Phusion site-directed mutagenesis using the following primer pairs ...
-
bioRxiv - Biophysics 2022Quote: ... This SETD3 mutant was introduced into EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) by Gibson Assembly (New England Biolabs).
-
bioRxiv - Biophysics 2022Quote: ... The SETD3 G361R mutant was introduced into EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) by Gibson Assembly (New England Biolabs). The SETD3 G361R construct was then used as a template to incorporate F409A or F409A and N413A mutations by Phusion site-directed mutagenesis using the following primer pairs ...
-
bioRxiv - Plant Biology 2022Quote: ... The vector and insert DNA fragments were assembled in a ratio of 1:5 using NEBuilder HiFi DNA Assembly (E5520S, New England Biolabs). The gl2L480P ...
-
bioRxiv - Cancer Biology 2022Quote: ... A minimum of 1 μg (20 ng/μl) of high-quality total RNA (extracted using Monarch Total RNA Miniprep Kit, NEB) was supplied for sequencing ...
-
bioRxiv - Cell Biology 2022Quote: INS-1 832/3 EV and g1-2 cells transiently expressing the SNAP-GLP-1R were labelled at 37°C with 1 μM of SNAP-Surface 649 fluorescent substrate (S9159S, New England Biolabs) in full media prior to treatment with 100 nM exendin-4 or vehicle for 3 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... pFastBac dual vector containing the sequence for the N-terminally 6xHis-tagged human Naa15 and truncated human Naa10 (residues 1-160) sequences was digested using KpnI-HF (NEB) and XmaI (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNAs were diluted 1:20 and then qPCR was carried out in triplicate using the Luna Universal qPCR Master Mix (New England Biolabs). 3 primer sets targeted different exon-exon junctions in the lmo7a coding region and primers targeting rps13a as the control housekeeping gene were used for normalization ...
-
bioRxiv - Microbiology 2020Quote: ... RT-PCR product sizes were analyzed in comparison to migration of markers in 100 bp and 1 kb ladders (New England Biolabs).
-
bioRxiv - Cancer Biology 2020Quote: ... Coverslips were treated with RNase A (Fermentas) for 1 hour at 37°C and where indicated with RNase H (NEB) for 24 hours at 37°C prior to blocking ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Genomics 2020Quote: ... Methylation reactions were performed in a 100 uL reaction with Methylation Reaction buffer (1X CutSmart Buffer,1 mM S-adenosyl-methionine (SAM, New England Biolabs)) and incubated with 2.5 uL EcoGII at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was pelleted at 18,000xg for 10 minutes and supernatant was removed before the pellet was resuspended in 50 μL trypsin reaction buffer and 1 μg trypsin (New England Biolabs) added and the suspension incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg of purified IE1 DNA was then digested with ClaI and SpeI restriction enzymes (New England Biolabs, Ipswich, MA). Digested DNA was cleaned using the DNA clean and concentrator kit (Zymo Research ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg pAd5-Blue was digested with ClaI and XbaI and dephosphorylated using Quick CIP (New England Biolabs, Ipswich, MA). Enzymes were heat inactivated by heating to 80 °C for 5 minutes and DNA precipitated using 100% ethanol ...
-
bioRxiv - Molecular Biology 2022Quote: ... MCC libraries were generated by digesting the chromatin in low Ca2+ MNase buffer (10 mM Tris-HCl pH7.5, 10 mM CaCl2) for 1 h at 37°C with MNase (NEB, M0247) added in varied concentrations (17-19 Kunitz U) ...