Labshake search
Citations for Illumina :
3501 - 3550 of 4662 citations for Genz 644282 CAS 529488 28 6 99% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... the sheared PCR products were processed using a Nextera XT DNA Sample Preparation Kit according to the manufacturer’s instructions (Illumina, San Diego, CA). All the libraries were sequenced at a 2×150 bp read length on an Illumina HiSeq 2000 platform ...
-
bioRxiv - Neuroscience 2020Quote: ... Detailed anatomical boundaries for each cortical region at each stage of development are provided elsewhere.[17,18] Regional tissue samples were subject to mRNA-sequencing using an Illumina Genome Analyzer IIx (Illumina, San Diego, CA) and mRNA-seq data processed using RSEQtools (v0.5).[123] Gene expression was measured as reads per kilobase of transcript per million mapped reads (RPKM) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA libraries were prepared using 100 ng of total RNA according to the manufacturer’s instructions for the Illumina TruSeq Stranded Total RNA Sample Prep Kit with Ribo-Zero Gold (Illumina, San Diego, CA). The concentration and size distribution of the completed libraries were determined using an Agilent Bioanalyzer DNA 1000 chip (Santa Clara ...
-
bioRxiv - Microbiology 2020Quote: ... Paired-end sequencing libraries were constructed and sequenced as 2×151 bp using the Illumina NovaSeq platform (Illumina Inc, San Diego, CA).
-
bioRxiv - Bioengineering 2020Quote: Preparation of phage dAb libraries for deep sequencing was completed following the Illumina Nextera XT amplicon sequencing protocol (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... and 40 from each of the 10 donors) were prepared with the TruSeq Stranded mRNA kit from Illumina (San Diego, CA, USA) and sequenced on a HiSeq 4000 sequencer (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μg of high-quality RNA for each sample was used for library preparation according to the Illumina TruSeq small RNA library protocol (Illumina Inc., CA). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... Genotyping was performed using single nucleotide polymorphism (SNP) microarrays (Infinium Global Screening Array v2.4. or Infinium OmniExpress-24; Illumina, San Diego, CA). Raw genotype files were converted to PLINK-compatible files using GenomeStudio software (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... Prepared libraries were sequenced for 76nt paired-end sequencing on HiSeq™ 4000 and NovaSeq6000™ sequencers (Illumina®, San Diego, CA).
-
bioRxiv - Cancer Biology 2020Quote: ... RNA libraries were prepared using 200 ng of good quality total RNA according to the manufacturer’s instructions for the TruSeq RNA Sample Prep Kit v2 (Illumina, San Diego, CA), employing poly-A mRNA enrichment using oligo dT magnetic beads ...
-
bioRxiv - Pathology 2021Quote: Genotyping was performed using single nucleotide polymorphism (SNP) microarrays (Infinium Global Screening Array v2.4. or the Infinium OmniExpress-24, Illumina, San Diego CA). Raw genotype files were converted to PLINK-compatible files using GenomeStudio software (Illumina ...
-
bioRxiv - Genomics 2020Quote: Total RNA obtained from plasma was desiccated to a volume of 2.5μl for library preparation with the TruSeq Small RNA Library Prep kit (Illumina, Inc., San Diego, CA) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The 300–500 short-insert libraries were sequenced with 91 bp paired-end reads using Illumina HiSeq2000 (Illumina, San Diego, CA, USA) by BGI Hong Kong ...
-
bioRxiv - Microbiology 2020Quote: ... as previously described.145,146 Deep-sequencing libraries were prepared using the Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA, USA) and sequenced on MiSeq (Illumina).
-
bioRxiv - Plant Biology 2020Quote: 42 RNA samples from experiment 1 were used for mRNA-Seq library preparation using the TruSeq Stranded mRNA Library Prep Kit (Illumina, CA, USA). Libraries were multiplexed and single-end 100 nt RNA-Seq was performed on a Novaseq 6000 at the GIGA Center (University of Liege ...
-
bioRxiv - Microbiology 2021Quote: Metagenomic sequencing libraries were constructed by Genome Quebec using an Illumina TruSeq DNA PCR-Free Library Preparation kit (Illumina, Inc., CA, US) with a final size selection of 400 bp ...
-
bioRxiv - Genomics 2021Quote: ... The best replicate from each tissue was selected for the transcriptome data set by preparing TrueSeq libraries (Illumina, San Diego, CA, USA). The rest of the samples were prepared with the Lexogen QuantSeq 3’mRNA kit (Lexogen ...
-
bioRxiv - Genomics 2020Quote: ... Complementary DNA (cDNA) libraries were constructed for each snail individual using TruSeq Stranded mRNA Sample Preparation Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The pooled library was sequenced on an Illumina MiSeq platform using a 2× 300-bp MiSeq Reagent Nano Kit v2 (Illumina, CA, USA).
-
bioRxiv - Microbiology 2020Quote: ... and these values were used to evenly pool libraries prior to sequencing with the Illumina MiSeq (Illumina Inc., San Diego, CA, USA).
-
bioRxiv - Microbiology 2020Quote: ... 2.5 µg of confirmed DNA-free total RNA was treated with Ribo-Zero rRNA Removal Kit for Bacteria according to the manufacturer’s instructions (Illumina, San Diego, CA). Following rRNA removal ...
-
bioRxiv - Microbiology 2020Quote: ... Metagenomic shotgun libraries were prepared for each sample using the Nextera XT DNA Sample Preparation Kit (Illumina Inc., San Diego, CA, USA) and sequencing was performed on an Illumina NextSeq500 platform with a 2 × 150 bp High Output run ...
-
bioRxiv - Microbiology 2020Quote: ... they were collected and their genomic DNA was pooled and analysed on an Illumina MiSeq bench-top sequencer (Illumina, San Diego, CA). Insertion sites (which included 35% of TA sites ...
-
bioRxiv - Cell Biology 2021Quote: ... They were then quantified by quantitative polymerase chain reaction (qPCR) and sequenced on a NextSeq500/550 System (Illumina, San Diego, CA, USA) according to the manufacturer instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were sequenced to 51 base pairs from both ends on an Illumina HiSeq 4000 instrument (Illumina, San Diego, CA, USA).
-
bioRxiv - Pathology 2022Quote: ... The RNA resultant from RIP of heart tissue or resultant from NHDF transfection with hnRNPC siRNA and the respective control construct was sequenced on an Illumina Nextseq 550 sequencer (Illumina, CA, USA) to 25-35 million single-end 75bp reads and >50 million paired-end 75 bp reads per sample ...
-
bioRxiv - Neuroscience 2022Quote: ... The mRNA sequencing (read length of 2×100 bases) was performed using Illumina HiSeq2000 and 2500 machines (Illumina, San Diego, CA, USA) as per the standard Illumina RNA-seq protocol ...
-
bioRxiv - Immunology 2022Quote: ... were pooled onto two lanes of an Illumina S2 flow cell and sequenced at a target depth of 25,000 reads per cell on an Illumina NovaSeq (Illumina, San Diego, CA). The 8 paired-end scRNA libraries were similarly pooled and sequenced at a target depth of 50,000 reads per cell ...
-
bioRxiv - Physiology 2022Quote: ... high-sensitivity spectrofluorometric measurement was poly-A selected and reverse transcribed using Illumina’s TruSeq stranded mRNA library preparation kit (Cat# 20020595; Illumina, San Diego, CA). Each sample was fitted with one of 96 adapters containing a different 8 base molecular barcode for high level multiplexing ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Systems Biology 2022Quote: ... The barcoded amplicons were sequenced on the Illumina MiSeq platform using 2 × 250 paired-end (PE) configuration (Illumina, San Diego, CA, USA).
-
bioRxiv - Genomics 2022Quote: ... a library was prepared from 1 μg of genomic DNA and a TruSeq DNA PCR-free Sample Preparation Kit (Illumina, CA, USA). Paired-end (151 bp per read ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial 16S rRNA V4 region was amplified during library preparation via Illumina’s Nextera XT Index Kit v2 (Illumina, Inc.; San Diego, CA) (primers ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were prepared with 1 μg of total RNA for each sample using a TruSeq Stranded mRNA Sample Prep Kit (Illumina, CA, USA). Paired-end sequencing (151 bp ...
-
bioRxiv - Genomics 2022Quote: ... Samples were then mixed and sequenced to target >20,000 reads per cell for gene expression libraries and >5,000 reads per cell for TCR libraries using NovaSeq S4 or HiSeq 4000 (Illumina. San Diego, CA) with at least 2×100 BP coverage (Extended Data Table 1).
-
bioRxiv - Genomics 2022Quote: ... USA) for short read sequencing as specified in the TruSeq DNA PCR-Free Reference Guide (Oct 2017, Illumina, San Diego, CA, USA). A library was prepared using a TruSeq DNA PCR-Free library preparation kit according to manufacturer guidance and was sequenced on a NextSeq500 instrument (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were multiplexed and sequenced with a 15% spike-in of PhiX DNA in an Illumina NovaSeq platform (Illumina, San Diego, CA) using a 200 cycle single-end read at the same facility ...
-
bioRxiv - Cancer Biology 2022Quote: ... individually indexed and compatible libraries were proportionally pooled (∽25 million reads per sample) for clustering in cBot system (Illumina, San Diego, CA). Libraries at the final concentration of 15 pM were clustered onto a single read (SR ...
-
bioRxiv - Cancer Biology 2022Quote: We prepared samples for RNA-seq using the TruSeq Stranded Total RNA Sample Preparation kit with RiboZero Gold (Illumina, San Diego, CA). We performed RNA sequencing for each sample to ∼ 80 million paired-end 150 bp reads on an Illumina NextSeq 500 (Princess Margaret Genomics Centre ...
-
bioRxiv - Biophysics 2022Quote: ... Whole-genome sequencing was performed on the Illumina NovaSeq platform using Truseq ChIP-seq library and protocols (Illumina, San Diego, CA, USA) with a minimum Phred quality score of 30 ...
-
bioRxiv - Genomics 2022Quote: ... The DNA extracts were shipped to the Wellcome Sanger Institute for sequencing on the Illumina HiSeq platform (Illumina, San Diego, CA, USA) with 100-bp paired-end reads ...
-
bioRxiv - Cell Biology 2022Quote: ... and stranded total RNA-seq libraries were prepared using the Illumina TruSeq RNA Sample Preparation v2 Kit (Illumina, San Diego, CA, USA) implemented on the liquid handling robot Beckman FXP2 ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA libraries were prepared using approximately 100 ng of total RNA according to the manufacturer’s instructions for the TruSeq Stranded mRNA Sample Prep Kit (Illumina, San Diego, CA), employing poly-A mRNA enrichment using oligo dT magnetic beads ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were diluted and 150 pg input cDNA was used with the Nextera XT DNA Library Preparation Kit (Illumina, San Diego, CA) to generate indexed libraries ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were sequenced in depth of 30 to 52 million paired-end 2×150bp reads on Illumina NovaSeq 6000 sequencer (Illumina, CA, USA).
-
bioRxiv - Developmental Biology 2020Quote: Eight samples of 10x Genomics Chromium scRNA-seq data were sequenced on five Illumina HiSeq 2500 flowcells (Illumina, San Diego, CA, USA). Data was processed with bcl2fastq (2.20 ...
-
bioRxiv - Neuroscience 2021Quote: ... Genome integrity of hiPSC lines was assessed by an Illumina Human CytoSNP-12v2.1 beadchip array and analysed using KaryoStudio software (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2020Quote: ... Two μg of genomic DNA from each organism was subjected to indexed-tagged pair-end sequencing on an Illumina Hiseq 2000 platform (Illumina, CA, USA) to generate 100 bp paired-end reads ...
-
bioRxiv - Immunology 2020Quote: ... was used to isolate total RNA that was processed to prepare cDNA libraries using TruSeq technology according to the manufacturer’s instructions protocol (Illumina, San Diego, CA). Libraries were sequenced using Illumina NovaSeq 6000 ...
-
bioRxiv - Immunology 2020Quote: RNA libraries were prepared using 100 ng of good quality total RNA according to the manufacturer’s instructions for the TruSeq RNA Sample Prep Kit v2 (Illumina, San Diego, CA) employing poly-A mRNA enrichment using oligo dT magnetic beads ...