Labshake search
Citations for Illumina :
301 - 350 of 435 citations for 8 Cyclopropylamino 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Dual indexed sequencing libraries were made out of 5 ng cDNA from the above preparations using Illumina Nextera library preparation kit according to manufacturer’s instructions (Illumina). Quality checked and equimolar pooled libraries were sequenced in a HiSeq 4000 Illumina system ...
-
bioRxiv - Cell Biology 2020Quote: ... rRNA was depleted from 5 μg of total RNA using the Ribo-Zero Gold Yeast rRNA Removal Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... since values ΔCq > 5 are not suitable for further downstream processing for Infinium HD FFPE Restore Protocol (Illumina, Inc.) and Infinium MethylationEPIC array (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... Ribosomal RNA (rRNA) was depleted from 5 ug of total RNA using the Ribo-ZeroTM Gold Kit (Illumina, Inc). Depleted mRNA was fragmented and converted to first-strand cDNA using Superscript III reverse transcriptase (Invitrogen) ...
-
bioRxiv - Genomics 2021Quote: ... and 5K samples were resuspended in 50 μl, 10 μl, and 5 μl of transposition mix (25 μl 2x TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: Gene expression data was generated with the Chromium Single Cell 5’ v3.1 assay (10X Genomics) and sequenced on the NovaSeq 6000 platform (S1 flow cell, Illumina). To generate gene-barcode count matrices ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Physiology 2024Quote: ... tagmented DNA was amplified by PCR in a reaction mix (5 µL DNA, 2.5 µL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina)) ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Cell Biology 2020Quote: ... Purified cells were lysed in ATAC lysis buffer for 5 min to get nuclei and then transposed with Tn5 transposase (Illumina) for 30 min ...
-
bioRxiv - Microbiology 2021Quote: PCR free shotgun libraries were prepared for each sample from 2.5 ug metagenomic DNAs by Exeter Sequencing Service for the metagenomic sequencing using the TruSeq DNA library Prep Kit (Illumina). The libraries were sequenced to approximately 7GBp using the HiSeq 2500 rapid run mode (2X 250 bp paired end ...
-
Diversified expression of gamma-protocadherins regulates synaptic specificity in the mouse neocortexbioRxiv - Neuroscience 2021Quote: We acquired 212.66 GB clean reads for the 5’ gene expression library and 183.30 GB for the 5’ pcdhg expression library from the sequencing platform NovaSeq 6000 (Illumina, Novogene). 5’ gene expression sequencing data were aligned by Cellranger v3.0.2 (10X Genomics) ...
-
bioRxiv - Genetics 2020Quote: ChIP-seq and DNase-seq libraries were prepared from 1-5 ng ChIP DNA or DNase DNA samples using NEBNext Ultra II DNA library Prep Kit (Illumina). Libraries were sequenced on an Illumina NextSeq 500 with single-end or paired-end 75 bp reads.
-
bioRxiv - Microbiology 2019Quote: ... The resulting amplicon library pool was diluted to 2 nM with sodium hydroxide and 5 mL were transferred into 995mL HT1 (Illumina) to give a final concentration of 10 pM ...
-
bioRxiv - Immunology 2019Quote: ... and a mixture of 8 VH family and IgM-specific primers (listed below) containing 5’ adaptors to allow barcoding by the Illlumina TruSeq multiplex pcr kit (Illumina). Resulting PCR products were subjected to 10 cycles of PCR using Illumina TruSeq indexing primers ...
-
bioRxiv - Genomics 2021Quote: ... cDNA and barcode libraries were checked for quality on an Agilent 4200 TapeStation, quantified by KAPA qPCR, and sequenced on a single lane (95% transcriptome, 5% barcode) on Novaseq6000 (Illumina) to an average depth of 100,000 reads per cell.
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced single-end for 75 cycles on one high-output flow cell of an Illumina NextSeq with 5% PhiX control (Illumina) added to provide sequence diversity ...
-
bioRxiv - Genomics 2021Quote: ... Following immunoprecipitation with Dynabeads Protein G beads (invitrogen) in PCR tubes, samples were subject to Tagmentation (5 µl Tagmentation Buffer, 1 µl Tagmentation DNA Enzyme (Illumina), 19 µl Nuclease free water ...
-
bioRxiv - Systems Biology 2020Quote: ... Sequencing was performed using custom read primer oligo1210 (5’-CTTGTGGAAAGGACGAAACACCGGTAATTTCTACTCTTGTAGAT) (HPLC purified, Integrated DNA Technologies) using NextSeq 1 × 75 nt High Output reagents (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... a PhiX spike-in of 2.5-5% was added to the pools (PhiX Sequencing Control v3; Illumina # FC-110-3001). Samples were run on the Illumina NextSeq 500 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 ng of each amplicon was dual indexed in a 5-cycle PCR reaction using the PCR module and indexed primers from the Nextera kit (Illumina). Resulting libraries were purified on AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 5’ CGT ACA GCG GCT TGT TGG CTG TGA, and fA23M, 5’ GCG CTC CAG CTC CTT CTG CCC ATA, primers to which the Illumina sequencing primer sequences were attached to their 5’ ends) ...
-
bioRxiv - Microbiology 2022Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110-3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Cancer Biology 2022Quote: ... using primers DCF01 5’-CTTGTGGAAAGGACGAAACACCG-3’ and DCR03 5’-CCTAGGAACAGCGGTTTAAAAAAGC-3’ and subjected to single-end 75 bp (SE75) high-throughput sequencing using a NextSeq550 (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Use of 250 pg of cDNA with 1/5 reaction of Illumina Nextera XT kit (Illumina, San Diego, CA, USA). The length distribution of the cDNA libraries was monitored using DNA High Sensitivity Reagent Kit on the Perkin Elmer Labchip GX system (PerkinElmer ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Cancer Biology 2020Quote: Genomic DNA from 28 samples in which scDNA-seq data showed at least 5% of homozygously mutated clones were analyzed by Illumina Omni2.5-8 SNP array ...
-
bioRxiv - Genomics 2019Quote: ... 5 mM MgCl2) containing 1 μl Tn5 transposase from the Nextera DNA Library Prep Kit (15028212, Illumina, San Diego, USA) and incubated at 37°C for 10min ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The ~2 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina) as previously described [79] ...
-
bioRxiv - Developmental Biology 2020Quote: ... and two different mate-pair libraries (3 kb and 5 kb) were prepared with a Nextera Mate Pair Library Prep Kit (Illumina). Sequencing libraries were run on the Illumina Hiseq 2500 sequencer with a read length of 150 bp ...
-
bioRxiv - Biochemistry 2019Quote: ... double indexed libraries (Nextera XT indices) were prepared from recovered library DNA from rounds 3–5 and sequenced on a MiSeq platform (Illumina) using a v3 chip as single 151 cycle reads37 ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclei were isolated from 100,000 cells and sequencing adapters were transposed for 30 minutes at 37°C using 5 μl of TDE1 (Nextera Tn5 transposase, Illumina). After PCR and gel purification ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... TASSEL 5 GBS v2 pipeline (52) was used to perform the SNP calling of the sequence data obtained from Illumina sequencing ...
-
bioRxiv - Genetics 2021Quote: ... The bone and reference captured library pools were diluted to 1 pM with a 5% spike-in of PhiX Control V3 (Illumina) for sequencing on a NextSeq 550 (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Single-indexed strand-specific cDNA library from total RNA samples (500 ng input with RIN ≥ 5) was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina) as per directions by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 μg of purified RNA for each sample was processed using the Ribozero rRNA Removal Kit (Gram-negative bacteria) (Illumina) according to the manufacturer’s instructions except that reaction volumes were reduced by 50% ...
-
bioRxiv - Genetics 2021Quote: ... and ribosomal RNA was depleted from 5 ug of total RNA using the Ribo-Zero™ Gold Kit (Illumina, Inc.). Depleted mRNA was fragmented and converted to first strand cDNA ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... The rRNA-depleted samples were used for TruSeq Stranded RNA Sample Prep kit to produce 5′ to 3′ strand-specific cDNA libraries (Illumina). A TruSeq SBS sequencing kit version 3 (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting 10 nM pool was denatured to 10 pmol with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 51 cycles (plus 7 cycles index read ...
-
bioRxiv - Microbiology 2019Quote: ... Ribosomal RNA (rRNA) was then depleted from each sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Immunology 2020Quote: ... 0.3 to 0.5 ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) in an 8μL reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA (rRNA) was subsequently depleted from each RNA sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing was performed at 5 million reads/sample in single-end mode with 150 nt read length on the NextSeq 500 platform (Illumina) using a Mid output sequencing kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Each pool was sequenced on the Illumina NextSeq 500 after the addition of 5% PhiX sequencing control library (FC-110-3002; Illumina) using the following settings ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...