Labshake search
Citations for Illumina :
51 - 100 of 435 citations for 8 Cyclopropylamino 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... which typed them for the Illumina OmniExpress panel (Infinium OmniExpressExome-8, v1.6; Illumina, San Diego, CA) following the manufacturer’s procedures and the CIDR’s standard quality-control methods ...
-
bioRxiv - Cancer Biology 2021Quote: ... the library was amplified using Phusion for 8 cycles and sequenced on Novaseq sequencer (Illumina, CA) to a target of 100M paired-end 150bp reads.
-
bioRxiv - Systems Biology 2020Quote: ... Cohort 2 gene expression data were measured using a Human Ref-8 BeadChip array (Illumina, Inc) with ∼22k probes ...
-
bioRxiv - Genomics 2022Quote: ... Genotyping was carried out using the HumanOmniExpressExome-8 v1.0 or v1.2 BeadChips with Infinium chemistry (Illumina). Genotypes were processed using the GenomeStudio Analysis software v2011.1 (Illumina ...
-
bioRxiv - Genetics 2019Quote: Genome-wide multipoint linkage analysis was performed using the HumanOmniZhongHua-8 BeadChip (Illumina, San Diego, USA) and based on genotypes of 6301 Tag SNPs with an averaged 0.5cM resolution ...
-
bioRxiv - Developmental Biology 2020Quote: ... and subsequently another 8-12 PCR cycles with the specific primers (Illumina Nextera XT index kit); samples were cleaned with PCR purification kit (Qiagen ...
-
bioRxiv - Genomics 2022Quote: ... DNA was genotyped at the Children’s Hospital of Philadelphia’s Center for Applied Genomics using the Infinium Omni2.5-8 v1.3 BeadChip (Illumina) on an iScan System instrument (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... Biotinylated cDNA (750 ng) was hybridized at 48°C to MouseRef-8 v2 expression beadchips (Illumina) for 16 h before washing and analyzing according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2023Quote: ... 8 µL of 100 pM pooled libraries were loaded into lanes of a HiSeq 4000 (Illumina). At least 30M reads per library were generated ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Microbiology 2020Quote: ... was performed with ~8 million reads / sample in single-end mode on the NextSeq 500 platform (Illumina) with the High Output Kit v2.5 (75 Cycles).
-
bioRxiv - Microbiology 2021Quote: ... pooled and sequenced using two lanes of HiSeqX (Illumina; 150bp paired-end; read length 28*8*91). Two biological replicates of each L ...
-
bioRxiv - Genetics 2022Quote: ... Individual sequencing barcodes were added to each sample by amplifying the 20 μL elution in a 50 μL Q5 NEBNext reaction with 0.5 uM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex) for sample demultiplexing post-sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: ... gene expression analysis was performed using Illumina’s Mouse Ref 8 Beadchip v1 (Illumina Inc, San Diego, CA). These datasets have been deposited in GEO as accession entry GSE22520 and described in Supplemental Table 1c ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Samples with a RIN >8 was outsourced to Novogene for library construction and sequencing (Illumina Platform (PE150)) with 20 M raw reads/sample ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Genetics 2021Quote: ... 1 µg of high quality total RNA sample (RIN >8) was processed using TruSeq Stranded mRNA kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library preparation of high-quality RNA (RIN >8) was performed using the TruSeq RNA sample preparation kit (Illumina). Raw sequencing data was aligned to human genome B38 ...
-
bioRxiv - Developmental Biology 2019Quote: ... with RIN values > 8 were subjected to Automated TruSeq stranded total RNA with RiboZero Gold library preparation (Illumina). Single-end 50 bp reads were generated with HiSeq2500 ...
-
bioRxiv - Genomics 2020Quote: ... Genome-wide genotyping of 200 ng genomic DNA from the remaining 207 patients was carried out using Infinium HumanOmni2.5-8 v1.2 BeadChip microarrays (Illumina). After completion of the assay ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Developmental Biology 2022Quote: Transposed DNA fragments were purified using the Qiagen MinElute kit and amplified 6-8 cycles using the Nextera (Illumina) PCR primers ...
-
bioRxiv - Neuroscience 2020Quote: ... and sequenced them using PE100 reads and 2 × 8 bp index reads on a Novaseq 6000 Sequencing System (Illumina) aiming for 1 million reads per cell.
-
bioRxiv - Systems Biology 2021Quote: ... Libraries of extracted RNAs whose A260/A280 >1.8 and RIN >8 were built using the Illumina TruSeqTM RNA sample preparation kit (RS-122-2001, Illumina) and sequenced by an illumina HiSeq 2000 system with paired-end 100-bp reads ...
-
bioRxiv - Cell Biology 2019Quote: ... 100 to 200ng of high-quality total RNA sample (RIN >8) was processed using TruSeq Stranded mRNA kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Genomics 2021Quote: ... The cell pellets were then resuspended in 20 μl, 10 μl, and 8 μl of transposition mix (25 μl 2×TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 µL was amplified and hybridized on the Infinium MehtylationEPIC BeadChip (EPIC array; Illumina, Inc., San Diego, CA, U.S.A.). All samples were randomized in a balanced manner for sex and Braak stage ...
-
bioRxiv - Immunology 2022Quote: ... 5,000-50.000 cells per experiment were centrifuged 5 minutes at 8°C, and resuspended in 25 µl transposase mixture (12.5 µl Tagmentation DNA buffer, 1 µl Tn5 transposase (Illumina), 10.75 µl nuclease-free water ...
-
bioRxiv - Genomics 2023Quote: ... 8 μl of modified DNA was subjected to methylation analysis on the Illumina Infinium MethylationEPIC BeadChip (Illumina, CA, USA) at UCL Genomics according to the manufacturer’s standard protocol.
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Genetics 2021Quote: ... Individual sequencing barcodes were added to each sample by amplifying the entire 40 μL elution in a 100 μL Q5 NEBNext reaction with 0.5 μM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex, Supplementary Table 14) for sample demultiplexing post-sequencing ...
-
bioRxiv - Genomics 2020Quote: ... Other libraries were sequenced on NextSeq 500 (1x 28 / 1×91 cycles plus 8 base index cycle) using the v2 150 cycle High Output kit (Illumina) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Multiple mate-paired libraries (3, 8, 12 and 16 kb) were also constructed using the Nextera Mate-Paired Library Construction kit (Illumina). Libraries were sequenced on the Illumina HiSeq 2500 sequencer using the Illumina TruSeq PE Cluster kit v3 and TruSeq SBS kit v3 (101 ...
-
bioRxiv - Immunology 2021Quote: ... 150 µl from the 14 pM pool was loaded into each well of an 8-well strip tube and loaded onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Genetics 2020Quote: ... Libraries that passed quality checks were then subjected to deep sequencing (8-47 × genome coverage; 19 × mean coverage, 11 × median coverage) by HiSeq 2500 (Illumina) or NovaSeq 6000 platforms (Illumina).
-
bioRxiv - Genomics 2019Quote: ... Libraries were pooled and sequenced via single end 50 bp reads on a HiSeq 2500 (6 libraries per lane) or HiSeq 4000 (8 libraries per lane)(Illumina).