Labshake search
Citations for Illumina :
251 - 300 of 435 citations for 8 Cyclopropylamino 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in ATAC lysis buffer for 5 min and then transposed with TN5 transposase (Illumina) for 30 min ...
-
bioRxiv - Genomics 2022Quote: ... We partitioned the genes into three categories: (1) >5-fold higher in Illumina (“Higher count in Illumina”); (2 ...
-
bioRxiv - Biochemistry 2020Quote: 5 µg total RNA isolated from Flag elution samples were treated with Yeast RiboZero Gold (Illumina, MRZY1306) according to the manufacturer’s instructions to remove yeast rRNAs from the samples ...
-
bioRxiv - Genomics 2021Quote: ... Nuclear isolation of 5×10^4 cells was followed by treatment with Nextera Tn5 enzyme (Illumina, 20034198) for 45 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... The 5’GEX libraries were sequenced each of on a separate lane of HiSeq4000 flow cell (Illumina) to target sequencing depth of 50,000 read pairs per sample ...
-
bioRxiv - Immunology 2022Quote: ... cells were lysed in ATAC lysis buffer for 5 minutes and then transposed with TN5 transposase (Illumina) for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 5 μg total RNA samples were treated with the Ribo-Zero™ rRNA removal procedure (Illumina) to enrich for mRNA ...
-
bioRxiv - Plant Biology 2022Quote: ... and 5 mM β-mercaptoethanol) and then subjected the nuclei to a transposition reaction with Tn5 (Illumina). The transposition reaction was performed with 25 μl of 2x DMF (66 mM Tris-acetate pH 7.8 ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 5 million 75-nt single reads per sample were determined using a NextSeq High Output (Illumina), with >96% of the reads having a Q30 quality.
-
bioRxiv - Cancer Biology 2023Quote: ... Samples that qualified (RIN>5) were prepped using the standard protocol for Illumina Stranded mRNA prep (Illumina). Sequencing was done using the Illumina NextSeq 2000 with paired-end 59 bp × 59 bp reads ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was tagmented in 5 technical replicates of 1 ng cDNA each using the Nextera XT Kit (Illumina), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and 5’-end RNA-seq library preparation using tagmentation-based modified Nextera XT DNA sample Preparation kit (Illumina). Libraries were tagged with a plate-specific i7 index and were pooled for sequencing on an Illumina NextSeq2000 platform ...
-
bioRxiv - Genomics 2019Quote: ... and reverse transcribed using 25 pmol RT primer (5’-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3’) for TRU-seq barcodes (RP1 primer, Illumina). A portion of the RT product was removed and used for trial amplifications to determine the optimal number of PCR cycles ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5’-end RNA-seq library preparation using tagmentation-based modified Nextera XT DNA sample Preparation kit (Illumina). Libraries were tagged with a plate-specific i7 index and were pooled by batches of 4-9 plates for sequencing on an Illumina NextSeq550 platform ...
-
bioRxiv - Microbiology 2021Quote: ... 5 ng of DNA was used as input to create Illumina sequencing libraries using the Nextera kit (Illumina). The samples were pooled and sequenced on an Illumina NextSeq 500 High Output system to obtain 2×150 bp reads ...
-
bioRxiv - Bioengineering 2021Quote: ... Additional adapters at 5’-end (P5 and SP1) and 3’-end (P7 and SP2) were designed by Illumina for sequencing purpose ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then lysed and fragmented in a single reaction (12.5 µl 2X Illumina TDE buffer, 2.5 µl 1% Tween-20, 2.5 µl 0.2% Digitonin, 5 µl water, 2.5 µl Illumina TDE1 enzyme). Samples were incubated at 37°C for 60 minutes and purified using the Zymo DNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Microbiology 2019Quote: ... 5-minute elongation step at 72°C was performed on a MiSeq system (Illumina Inc, San Diego, California). After amplification ...
-
bioRxiv - Plant Biology 2020Quote: ... custom adapters for selecting 5’-P mRNAs and primers from the TruSeq Small RNA Sample Preparation Kit (Illumina) for multiplexing the libraries as indicated in Zhai et al (2014) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Tagment DNA Enzyme and 20 μl nuclease free water (Nextera DNA Sample Preparation Kit, Illumina, UK) for 45 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... The library was diluted to a final concentration of 7 pM and 5% of PhiX DNA (Illumina, USA) was added ...
-
bioRxiv - Microbiology 2021Quote: ... Amplicon libraries were mixed with 5% PhiX and sequenced with four MiSeq reagent kits v2 500 cycles (Illumina). A blank extraction kit control ...
-
bioRxiv - Immunology 2021Quote: ... The 5’ gene expression libraries were sequenced following 10X Genomics read length guidelines on the NovaSeq6000 sequencer (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Systems Biology 2022Quote: ... were lysed and transposed simultaneously in 25 µl of transposition mix (0.1% NP40, 0.1% Tween-20, 0.01% digitonin and 5% Tn5 enzyme (Illumina # 15027865) in Tagment DNA Buffer (FC-121–1030 ...
-
bioRxiv - Systems Biology 2023Quote: ... 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina) at the UCSD IGM core ...
-
bioRxiv - Microbiology 2023Quote: ... Fastq files for 5′ libraries sequenced with the extended R1 strategy were generated using bcl2fastq v2.20.0 (Illumina, Inc). Extended R1 fastqs were then separated into “pseudo R1” fastqs ...
-
bioRxiv - Systems Biology 2023Quote: ... approximately 5×104 cells were lysed and transposed reactions were carried out using Tn5 Transposase (Illumina, #FC121-1030) at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... The amplified DNA was then pooled to a 10 nM final concentration followed by a 5% PhiX (Illumina) spike and sequenced in a PE100 run on a HiSeq 4000 sequencer (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... sgRNA inserts were PCR amplified (primers listed in Supplementary Table 5, purified and sequenced on a NextSeq (Illumina). Sequencing reads were mapped and the abundance of each sgRNA was tallied ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genetics 2021Quote: ... The pellet was resuspended in 10 µL of transposition mixture (5 µL TD buffer, 3.2 µL PBS, 0.89 µL Tn5 (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were collected and subject to tagmentation at 37 °C for 30 minutes in adjusted tagmentation buffer (2x TD Tagment buffer + Digitonin 0.01% + 5 ul of TDE Tagment DNA enzyme from Illumina). Reaction was stopped with 0.2% SDS and DNA was collected using Qiaquick PCR purification columns and eluted in 10 μl 10 mM Tris ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded mRNA library preparation kit (Illumina, Inc., Cat No.20020594/5) including poly-A selection ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2019Quote: ... We tagmented 5 ng of cDNA using 1 uL Nextera Tagment DNA Tn5 transposase (Illumina, San Diego, CA, 15027916) in a 10 uL tagmentation mix for 10 minutes at 55 °C.
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...