Labshake search
Citations for Illumina :
1 - 50 of 435 citations for 8 Cyclopropylamino 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Genomics 2019Quote: ... and three mate-pair libraries (insert sizes of 2 kb, 5 kb, and 8 kb) were constructed using the TruSeq PCR-free Kit (Illumina) and Mate-pair Kit (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... The samples were amplified for 5-8 cycles as determined by qPCR for Illumina sequencing using Nextera library preparation kit (Illumina) and samples were paired-end sequenced on HiSeq4000 ...
-
bioRxiv - Genomics 2023Quote: ... We used 15 mins incubation on ice in the nuclei preparation step and the Tn5 reaction was performed in 50 μl of custom transposition buffer (10 mM Tris pH 8, 5 mM MgCl2 and 10% dimethylformamide) with 2.5 μl Tn5 transposase (Illumina, 20034197) at 37°C while mixing at 1000 rpm for 30 mins ...
-
bioRxiv - Molecular Biology 2020Quote: ... 12 times 8 Nextera (Illumina) based primer combinations were used ...
-
bioRxiv - Microbiology 2021Quote: ... 8) DC3000 − B (Illumina only), 9 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Microbiology 2021Quote: ... The purified PCR products were then processed and sequenced using the NextSeq 75 – High Output (82 cycles in read 1, 8 cycles in index 1, and 8 cycles in index 2 SE reads) (Illumina). The sequencing data was analyzed using the Model-Based Analysis of Genome-wide CRISPR/Cas9 Knockout (MAGeCK ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were sequenced Paired-End 151 bases (in addition: 8 bases for index 1 and 8 bases for index 2) setup using the NovaSeq 6000 instrument (Illumina) and the S1 Flow-Cell loaded at a final concentration in Flow-Lane loaded of 340pM and including 1% PhiX.
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were sequenced Paired-End 51 bases (in addition: 8 bases for index 1 and 8 bases for index 2) setup using the NovaSeq 6000 instrument (Illumina). SP Flow-Cell was loaded at a final concentration in Flow-Lane loaded of 400pM and including 1% PhiX ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were sequenced Single-reads 76 bases (in addition: 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 (Illumina) using the NextSeq 500 High Output Kit 75-cycles (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... Genotyping was performed using Infinium Omni2.5-8 arrays (Illumina) at the UCSD Institute for Genomic Medicine ...
-
bioRxiv - Genomics 2020Quote: ... Genotyping was performed using Infinium Omni2.5-8 arrays (Illumina) at the UCSD Institute for Genomic Medicine ...
-
bioRxiv - Microbiology 2020Quote: ... then further diluted to 8 pM in HT1 buffer (Illumina) and were sequenced using an Illumina MiSeq V2 500 cycle kit cassette with 16S rRNA library sequencing primers set for 250 base pair ...
-
bioRxiv - Immunology 2023Quote: ... 8 bp Index 1 on a NextSeq 550 sequencer (Illumina). Primers used for sample indexing PCR are listed in Extended Data Table 5.
-
bioRxiv - Immunology 2022Quote: ... Index read 1:8 cycles or on a HiSeq X (Illumina), using a 150 cycle flowcell with the read configuration ...
-
bioRxiv - Neuroscience 2019Quote: ... Index 2: 8 cycles) across 2 runs on a NextSeq 500 (Illumina) with an average read depth across biological replicates of 8,815 reads per cell.
-
bioRxiv - Microbiology 2021Quote: ... The 8 pM library containing 15% PhiX control v3 (Illumina Canada, Canada) was sequenced on a MiSeq instrument (Illumina Inc ...
-
bioRxiv - Immunology 2020Quote: ... cell nuclei were isolated and transposed with 8 μL Tn5 (Illumina Nextera) at 37°C for 60 minutes ...
-
bioRxiv - Bioengineering 2023Quote: Total RNA samples (RIN > 8) were sequenced on HiSeq 1500 (Illumina Inc.) using HiSeqV2 Rapid chemistry according manufacturer’s instructions in Monash Health Translation Precinct RNA-Seq facility ...
-
bioRxiv - Microbiology 2019Quote: ... 2x 8 nt dual indexed adapters from TruSeq RNA CD index kit (Illumina) were added to the libraries for multiplexing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were sequenced 2 * 50+8+16 bp on a HiSeq2500 sequencer (Illumina). RNA-seq data were processed according to Doyle et al ...
-
bioRxiv - Systems Biology 2023Quote: ... and biotinylated as described 8 using HumanHT-12 v4 Expression BeadChips (Illumina, Inc.). Gene expression data were extracted and log2-transformed using GenomeStudio software (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... 8 µL of i7 primer (NEBNext Multiplex Oligos for Illumina (Dual Index primers); NEB #E7600S ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Systems Biology 2022Quote: ... Individual samples were hybridized to Illumina MouseRef-8 Expression BeadChips (Illumina, San Diego, CA) by Southern California Genotyping Consortium (SCGC ...
-
bioRxiv - Cell Biology 2022Quote: ... 8 plates of mRNA libraries were sequenced using the Nextseq550 high output kit (Illumina) with 35 paired-end reads according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ➢ Distinct from currently used length 8 barcodes from common library kits (Illumina TruSeq, NEB)
-
bioRxiv - Systems Biology 2020Quote: ... i7 index 8 cycles and Read 2 56 cycles on a NextSeq500 instrument (Illumina) using High Output v2.1 chemistry ...
-
bioRxiv - Cancer Biology 2020Quote: ... ATAC-seq libraries (~8 per lane) were sequenced on a HiSeq 4000 platform (Illumina) by the University of Manchester Genomic Technologies Core Facility ...
-
bioRxiv - Immunology 2020Quote: PBMCs from 10 donors were genotyped using Infinium Omni2.5-8 v1.3 BeadChip Array (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... diluted to a concentration of 4pM and an 8% denaturalized PhiX control (Illumina, USA) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... Whole-genome SNP genotyping (SNP array) was conducted using Infinium OmniExpressExome-8-BeadChip (Illumina) and GenomeStudio V2.0.3 (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... 58°C on two Illumina MouseRef-8 v2.0 Expression BeadChips (Illumina, San Diego, CA, USA). Post-hybridization data read-out ...
-
bioRxiv - Plant Biology 2019Quote: ... 8-11 kb size were made following the standard Illumina protocols (Illumina, San Diego, CA) and sequenced with HiSeq4000 platform (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... Genotyping array analysis was performed by Psomagen with an Infinium Omni 2.5-8 kit (Illumina). To detect SVA ...
-
bioRxiv - Neuroscience 2019Quote: ... 750 ng of the labeled cRNA was hybridized to MouseRef-8 v2 expression beadchips (Illumina) for 16 h before washing and analyzing according to the manufacturer’s directions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Prepared libraries for all 8 samples were pooled and sequenced on a NovaSeq 6000 (Illumina) using 2×96 paired end reads to capture sample index ...
-
bioRxiv - Immunology 2020Quote: ... We genotyped patients using the Illumina OmniExpressExome-8 Bead Chip (Illumina, San Diego, CA, USA).
-
bioRxiv - Genetics 2020Quote: ... The samples were sequenced on a total of 8 lanes using a HiSeq3000 instrument (Illumina) with a single end flowcell for 75 cycles ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...