Labshake search
Citations for Illumina :
101 - 150 of 491 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: The USEARCH pipeline (v.11) [44] was used to process the data obtained from Illumina sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... converted into cDNA and sequenced using an Illumina Hiseq®2500 v.2 (Illumina, Singapore), 150 bp paired- end ...
-
bioRxiv - Immunology 2022Quote: ... Both gene expression and V(D)J libraries were sequenced on a Novaseq S4 (Illumina), targeting a median sequencing depth of 50,000 and 5,000 read pairs per cell ...
-
bioRxiv - Microbiology 2024Quote: ... or TCR/BCR V(D)J libraries were sequenced on a NovaSeq sequencing platform (Illumina) with a target of 50,000 read pairs per cell.
-
bioRxiv - Immunology 2024Quote: ... Both gene expression and V(D)J libraries were sequenced on a NovaSeq 6000 (Illumina), targeting a median sequencing depth of 50,000 and 5,000 read pairs per cell ...
-
bioRxiv - Immunology 2024Quote: ... Both gene expression and V(D)J libraries were sequenced on a Novaseq S4 (Illumina), targeting a median sequencing depth of 50,000 and 5,000 read pairs per cell ...
-
bioRxiv - Bioengineering 2024Quote: ... Data in resulting fastq.gz files were demultiplexed with bcl-convert v 4.2.4 software from Illumina.
-
bioRxiv - Cancer Biology 2024Quote: ... Analysis of DNA methylation was performed using the Infinium Methylation EPIC v.2.0 Kit (Illumina) according to the manufacturer’s protocol and as described in Honkova et al ...
-
bioRxiv - Genetics 2024Quote: ... with genotyping performed using the Infinium Global Diversity Array-8 v.10 Kit (Illumina #20031669). RNA extraction utilized the RNeasy kit (Qiagen #74104 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
bioRxiv - Microbiology 2020Quote: ... 0.75 M sucrose) and R1804M Ready-Lyse lysozyme solution (Illumina, USA). After 15 minutes of incubation at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biochemistry 2024Quote: ... with 5% phiX (Illumina, FC-110-3001) was loaded to the sequencer ...
-
bioRxiv - Cancer Biology 2021Quote: ... indexed adapter ligation and PCR amplification—using the TruSeq RNA v.2 Library Preparation kit (Illumina). The captured library was pooled with other libraries ...
-
bioRxiv - Immunology 2021Quote: ... HASHing libraries were sequenced on an Illumina NextSeq 500/550 (NextSeq Control Software v 2.2.0.4 / Real Time Analysis 2.4.11) using a NextSeq 60 cycles kit (Illumina, 20456719) as follows ...
-
bioRxiv - Cancer Biology 2021Quote: ... and differential expression was determined using the RNA-Seq Alignment (v.2.0.2) and RNA-Seq Differential Expression (v1.0.1) Basespace applications (Illumina). Gene Set Enrichment Analysis (GSEA ...
-
bioRxiv - Plant Biology 2021Quote: ... Sequencing data were demultiplexed with the bcl2fastq Conversion Software (v. 2.20, Illumina; San Diego, California, USA).
-
bioRxiv - Immunology 2022Quote: ... All BCR enriched V(D)J libraries were pooled together and sequenced on a NextSeq500 (Illumina) using the same parameters as previously mentioned.
-
bioRxiv - Immunology 2020Quote: ... Sequencing data were demultiplexed using the bcl2fastq Conversion Software (v. 2.20, Illumina; San Diego, California, USA). The quality of the resulting reads was assessed with ShortRead (v ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequenced on an Illumina HiSeq 2000 sequencer (RRID:SCR_020132, v.4, Illumina, San Diego, California, USA) in 50 bp single-end mode by Genomics and Proteomics Core facility ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Raw reads were quality checked using FastQC v.0.11.8 (Andrews et al., 2010) followed by Illumina adapter removal using Trimmomatic v.0.38 ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Plant Biology 2024Quote: ... cDNA libraries were prepared with Illumina TruSeq RNA Sample Preparation Kit v.2 (Illumina, United States) from the extracted RNA ...
-
bioRxiv - Immunology 2024Quote: ... Next-generation sequencing libraries were prepared with the TruSeq RNA Library Prep kit v.2 (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Raw BCL files were converted to FastQ files and de-multiplexed using bcl2fastq v.2.1.9 (Illumina), keeping only >Q30 reads with 150 bp in length ...
-
bioRxiv - Plant Biology 2020Quote: 126 cDNA libraries were prepared using the Illumina TruSeq RNA Sample Preparation Kit v.2 (Illumina, USA) from isolated RNA ...
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... and data analyses were performed with the Illumina GenomeStudio-Software v.2011.1 (Illumina, San Diego, CA, USA).
-
bioRxiv - Plant Biology 2021Quote: ... RNAseq libraries were prepared using the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) and barcoded individually following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... Genotypes were called using GenTrain 2.0 cluster algorithm in GenomeStudio software v.2011.1.0.24550 (Illumina, San Diego, CA). Genotyping quality control criteria considered the missing call rate ...
-
bioRxiv - Molecular Biology 2022Quote: Illumina sequencing output data were converted to .fastq data format using bcl2fastq software (v.2.20, Illumina, USA). Quality controls were performed throughout the analysis with FastQC (Andrews S ...
-
bioRxiv - Genetics 2021Quote: ... the DNA sequencing reads (pre-mapped to the X chromosome by Illumina’s ISIS Analysis Software v.2.5.26.1352) were realigned to the GRCh38 X chromosome reference sequence using BWA-MEM in SpeedSeq v0.1.253 ...
-
bioRxiv - Immunology 2021Quote: RNA libraries were sequenced on an Illumina NovaSeq 6000 (NovaSeq Control Software v 1.6.0 / Real Time Analysis v3.4.4) using a NovaSeq S4 230 cycles kit (Illumina, 20447086) as follows ...
-
bioRxiv - Genomics 2023Quote: ... The resulting sequencing libraries were sequenced using the MiSeq system (Illumina v.2 kit, 2 × 150 bp).
-
bioRxiv - Immunology 2023Quote: ... V(D)J region-enriched libraries were pooled and sequenced using the NovaSeq 6000 Sequencing System (Illumina).
-
bioRxiv - Genetics 2022Quote: ... cDNA libraries were prepared using the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) and sequenced in single-end 100-bp reads on an Illumina HiSeq4000 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cDNA libraries were prepared using the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA). Sequencing was performed on an Illumina HiSeq XTen/NovaSeq/BGI platform by a commercial service (Biomarker Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... genomic DNA was extracted using QuickExtract ™ DNA Extraction Solution (Illumina, USA), and PCR amplification using primers encompassing the CRISPR target site ...
-
bioRxiv - Plant Biology 2022Quote: ... Five μL of this solution was added to 995μL of HT1 (Illumina) to give a final concentration of 10pM ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...