Labshake search
Citations for Illumina :
1351 - 1400 of 1472 citations for ssc mir 17 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... PCR amplicons were sequenced on an Illumina MiSeq instrument (v2 chemistry, 150 bp paired end reads) (Illumina, San Diego, CA, USA). Data were analyzed using a custom-built pipeline ...
-
bioRxiv - Genetics 2019Quote: ... The libraries were amplified using the NPM mix (Nextera PCR Master Mix from Nextera DNA Library Prep Kit) and Index adapters i7 and i5 (Nextera Index Kit, Illumina, U.S), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... TruSeq PCR-Free Low Throughput libraries were prepared for each DNA sample following the manufacturer’s instructions (Illumina, San Diego, CA, USA). Each sample had a unique index from Illumina TruSeq DNA CD Indexes (96 indexes/samples) ...
-
bioRxiv - Biochemistry 2020Quote: ... Sheared DNA was used to construct the library using the Illumina TruSeq DNA PCR-Free Low Throughput Library Prep Kit (Illumina, 20015962). After adapter ligation ...
-
bioRxiv - Plant Biology 2020Quote: ... The sequencing step of PCR fragments was done on an Illumina Miseq personal sequencer using the MiSeq Reagent Kit v3 (Illumina®) followed by quality control processes for libraries using the PippinHT system from SAGE Sciences for libraries purification ...
-
bioRxiv - Microbiology 2022Quote: ... 1 µg of gDNA per sample was analyzed using the TruSeq® DNA PCR-Free Low-Throughput Library Prep Kit (Illumina) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2020Quote: ... PCR-generated amplicon libraries were subjected to 250 nt paired-end sequencing on a MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2021Quote: Short-read paired-end sequencing of DNA and rRNA-depleted samples was performed on the Illumina Novaseq platform (S prime, 2x 150 bp) using TruSeq PCR free DNA library preparation kit (Illumina Inc.).
-
bioRxiv - Microbiology 2019Quote: ... The libraries generated with TruSeq DNA PCR-Free Sample Preparation Kit were sequenced using paired-end Illumina sequencing (2 × 250 bp) on the HiSeq2500 platform (Illumina, USA).
-
bioRxiv - Genomics 2019Quote: ... Dovetail staff then prepared a sequencing library by inputting fragmented DNA to the TruSeq DNA PCR-Free Library Preparation Kit (Illumina, Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Evolutionary Biology 2019Quote: We assessed input gDNA quantity using Qubit and normalised the samples to 20ng/ul as described in TruSeq®DNA PCR-Free Library Prep Reference Guide (#FC-121-3001, Illumina) prior fragmentation to 350bp with Covaris S2 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 500 ng of the purified and pooled PCR genome amplicons were prepared for sequencing via Nextera DNA Flex Kit (Illumina, #20018705) with 96 indexes (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... Illumina sequencing adapters were added by PCR using 12 cycles of amplification (Illumina Cat. FC-131-1024 and FC-131-2001). Final sequencing libraries were purified and size selected using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2019Quote: ... or the Illumina TruSeq DNA PCR-free LT sample preparation kit (Illumina, Part no. FC-121–3001 and FC-121–3002) according to the manufacturer’s protocols with some modifications (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the above elute as template ...
-
bioRxiv - Microbiology 2021Quote: ... A 50µl aliquot of the final pooled PCR product was sequenced at the UC Davis Genome Center DNA Technologies Core via the Illumina MiSeq PE250 platform (Illumina, CA).
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... RNA fragmentation was performed at 94°C for 6 minutes and 10 PCR cycles were used during library amplification with TruSeq single-index adapters (Illumina, #20020492). Final library concentrations were quantified with both Qubit fluorometric quantification (DNA dsDNA HS kit ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1.1 micrograms of extracted DNA was utilized as starting material for TruSeq DNA PCR-Free library preparation kit (Illumina Inc., USA). The DNA was fragmented using focused ultrasonicator (Covaris M220 ...
-
bioRxiv - Genetics 2021Quote: 5× HOT FIREPol® EvaGreen® qPCR Mix Plus with ROX (Solis Biodyne) and an Eco Real-Time PCR System (Illumina) were used for qPCR ...
-
bioRxiv - Genomics 2021Quote: PCR-free Illumina libraries were generated from 1 μg genomic DNA using a Covaris LE220-plus to shear the DNA and the TruSeq® DNA PCR-Free HT Sample Preparation Kit (Illumina) for library generation ...
-
bioRxiv - Genomics 2020Quote: ... the fragmented amplicons were cleaned-up and amplified by 5 cycles of PCR using specific index adapters for Illumina sequencing (Nextera™ DNA CD Indexes, Illumina) (Supplementary Figure 1B) ...
-
bioRxiv - Immunology 2022Quote: ... The PCR product library was quantitated and subjected to sequencing on an Illumina MiSeq sequencer (Illumina, San Diego, CA 92122 USA). HLA alleles and genotypes were called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Bioengineering 2022Quote: ... The primers T7_Endo_Lib_LONG_FOR GCCCTCTGTGTGAATTCT and T7_Endo_Lib_LONG_REV GTCACCGACACAAGCTTA were used and a second round of PCR was carried out with the IDT for Illumina UD indexes (Illumina Corp.) to add adapter tags ...
-
bioRxiv - Immunology 2022Quote: ... multiplex PCR was used to amplify rearranged VDJ sequences followed by high throughput sequencing using Illumina technologies (Illumina, San Diego, CA). PCR amplification bias was minimized by internal controls in the ImmunoSEQ assay29 ...
-
bioRxiv - Microbiology 2022Quote: ... TraDIS adapters were used for adapter ligation and PCR amplified for final library construction using the Nextera XT DNA kit (Illumina, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Illumina sequencing adapters and dual index barcodes were added to each library using an Index PCR (Illumina XT Index Kit v2) followed by PCR clean-up with AMPure beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2023Quote: ... The DNA was sent for library construction with TruSeq DNA PCR-free library prep kit with 350-bp insert (Illumina, USA) prior to sequencing with Illumina HiSeq 2500 platform on rapid run mode generating 2×250 bp (Macrogen Inc ...
-
bioRxiv - Immunology 2022Quote: ... and PCR products were sent to the @BRIDGe platform for sequencing on an Illumina MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Plant Biology 2023Quote: Short read WGS libraries for Lg7742a and Lj8627 were prepared from 2µg of HMW gDNA using the Illumina TruSeq DNA PCR-Free kit (Illumina, cat#20015962) and sequenced on an Illumina MiSeq (PE 250bp ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were then indexed and PCR amplified (10 cycles) and sequenced on Illumina HiSeq 2500 sequencing platform following the manufacture’s protocols (Illumina, Hayward CA).
-
bioRxiv - Molecular Biology 2023Quote: ... PCR-amplified libraries were quantified on a Bioanalyser and appropriately diluted and multiplexed for deep sequencing (Illumina MiSeq 2×75 bp).
-
bioRxiv - Microbiology 2023Quote: ... Libraries for whole-genome sequencing (WGS) were built using a TruSeq DNA PCR-Free Low Throughput Library Prep Kit (Illumina, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Equal amounts of PCR product (2 µl 4nM) were pooled and sequenced on an Illumina MiSeq Sequencer (Illumina, San Diego, USA) using a paired-end 300bp V3 kit at Utrecht Sequencing Facility (www.useq.nl).
-
bioRxiv - Genomics 2023Quote: ... and Illumina PCR-free libraries with insert sizes of 350-bp were constructed using Truseq Nano DNA HT Sample preparation Kit (Illumina USA). Finally ...
-
bioRxiv - Plant Biology 2023Quote: ... The libraries were prepared using the TruSeq DNA PCR-Free kit and sequenced on the HiSeq RR-PE100 system (Illumina, USA). This resulted in approximately 188 million reads in total or about 94 million reads per pooled sample ...
-
bioRxiv - Biophysics 2023Quote: ... We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the elute as template ...
-
bioRxiv - Genetics 2022Quote: ... Library preparation of the LR-PCR products was performed using a Nextera XT DNA Library Preparation Kit (Illumina Inc., CA, USA). For 96 Sudanese samples ...
-
bioRxiv - Evolutionary Biology 2021Quote: Libraries for each individual starling were constructed using a TruSeq DNA PCR-free High Throughput Library Prep Kit (Illumina, San Diego, CA). All individuals passed the initial quality check with FASTQC (Babraham Bioinformatics ...
-
bioRxiv - Genomics 2020Quote: ... sequencing libraries of the two deeply sequenced samples were constructed with 1.8-2 μg sample DNA and the TruSeq DNA PCR-Free kit (Illumina, San Diego, CA). The remaining 74 paired-end short insert (350 nt ...
-
bioRxiv - Genomics 2020Quote: ... Samples were prepared for sequencing using 1 ug of genomic DNA following the TruSeq PCR free kit protocol (Illumina, FC-121-3001). Resulting libraries were quality checked on an Agilent DNA 1000 bioanalyzer (Agilent Technologies ...
-
bioRxiv - Plant Biology 2019Quote: ... one DNA library was prepared using the PCR-free TruSeq DNA sample preparation kit following the manufacturer’s instructions (Illumina, San Diego, CA), and sequenced on an Illumina MiSeq instrument (paired-end 2×250bp ...
-
bioRxiv - Genomics 2019Quote: The PCRfree libraries were constructed using DNA from adult female animals with the Truseq PCR free kit (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol using 1 μg DNA as input ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR-generated amplicon libraries were subjected to 250 nt paired-end sequencing on a MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Genomics 2019Quote: Illumina sequencing libraries for both parents (i.e. sire and dam) and F1 fetus were prepared using TruSeq PCR-free preparation kits (Illumina, San Diego, CA). A total of ∼55x ...
-
bioRxiv - Genomics 2019Quote: ... Multiple shotgun genomic libraries were prepared using Illumina TruSeq DNA PCR-free library preparation kit and Nextera XT sample preparation kit (Illumina Inc., USA) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... the sheared PCR products were processed using a Nextera XT DNA Sample Preparation Kit according to the manufacturer’s instructions (Illumina, San Diego, CA). All the libraries were sequenced at a 2×150 bp read length on an Illumina HiSeq 2000 platform ...
-
bioRxiv - Microbiology 2021Quote: Metagenomic sequencing libraries were constructed by Genome Quebec using an Illumina TruSeq DNA PCR-Free Library Preparation kit (Illumina, Inc., CA, US) with a final size selection of 400 bp ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Genomics 2022Quote: ... a library was prepared from 1 μg of genomic DNA and a TruSeq DNA PCR-free Sample Preparation Kit (Illumina, CA, USA). Paired-end (151 bp per read ...