Labshake search
Citations for Illumina :
1301 - 1350 of 1399 citations for ssc mir 17 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: 5× HOT FIREPol® EvaGreen® qPCR Mix Plus with ROX (Solis Biodyne) and an Eco Real-Time PCR System (Illumina) were used for qPCR ...
-
bioRxiv - Genomics 2021Quote: PCR-free Illumina libraries were generated from 1 μg genomic DNA using a Covaris LE220-plus to shear the DNA and the TruSeq® DNA PCR-Free HT Sample Preparation Kit (Illumina) for library generation ...
-
bioRxiv - Genomics 2020Quote: ... the fragmented amplicons were cleaned-up and amplified by 5 cycles of PCR using specific index adapters for Illumina sequencing (Nextera™ DNA CD Indexes, Illumina) (Supplementary Figure 1B) ...
-
bioRxiv - Immunology 2022Quote: ... The PCR product library was quantitated and subjected to sequencing on an Illumina MiSeq sequencer (Illumina, San Diego, CA 92122 USA). HLA alleles and genotypes were called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Bioengineering 2022Quote: ... The primers T7_Endo_Lib_LONG_FOR GCCCTCTGTGTGAATTCT and T7_Endo_Lib_LONG_REV GTCACCGACACAAGCTTA were used and a second round of PCR was carried out with the IDT for Illumina UD indexes (Illumina Corp.) to add adapter tags ...
-
bioRxiv - Immunology 2022Quote: ... multiplex PCR was used to amplify rearranged VDJ sequences followed by high throughput sequencing using Illumina technologies (Illumina, San Diego, CA). PCR amplification bias was minimized by internal controls in the ImmunoSEQ assay29 ...
-
bioRxiv - Microbiology 2022Quote: ... TraDIS adapters were used for adapter ligation and PCR amplified for final library construction using the Nextera XT DNA kit (Illumina, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Illumina sequencing adapters and dual index barcodes were added to each library using an Index PCR (Illumina XT Index Kit v2) followed by PCR clean-up with AMPure beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2023Quote: ... The DNA was sent for library construction with TruSeq DNA PCR-free library prep kit with 350-bp insert (Illumina, USA) prior to sequencing with Illumina HiSeq 2500 platform on rapid run mode generating 2×250 bp (Macrogen Inc ...
-
bioRxiv - Immunology 2022Quote: ... and PCR products were sent to the @BRIDGe platform for sequencing on an Illumina MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... Libraries for whole-genome sequencing (WGS) were built using a TruSeq DNA PCR-Free Low Throughput Library Prep Kit (Illumina, USA) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR-amplified libraries were quantified on a Bioanalyser and appropriately diluted and multiplexed for deep sequencing (Illumina MiSeq 2×75 bp).
-
bioRxiv - Genomics 2023Quote: ... and Illumina PCR-free libraries with insert sizes of 350-bp were constructed using Truseq Nano DNA HT Sample preparation Kit (Illumina USA). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... Equal amounts of PCR product (2 µl 4nM) were pooled and sequenced on an Illumina MiSeq Sequencer (Illumina, San Diego, USA) using a paired-end 300bp V3 kit at Utrecht Sequencing Facility (www.useq.nl).
-
bioRxiv - Plant Biology 2023Quote: ... The libraries were prepared using the TruSeq DNA PCR-Free kit and sequenced on the HiSeq RR-PE100 system (Illumina, USA). This resulted in approximately 188 million reads in total or about 94 million reads per pooled sample ...
-
bioRxiv - Biophysics 2023Quote: ... We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the elute as template ...
-
bioRxiv - Genetics 2022Quote: ... Library preparation of the LR-PCR products was performed using a Nextera XT DNA Library Preparation Kit (Illumina Inc., CA, USA). For 96 Sudanese samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were then indexed and PCR amplified (10 cycles) and sequenced on Illumina HiSeq 2500 sequencing platform following the manufacture’s protocols (Illumina, Hayward CA).
-
bioRxiv - Plant Biology 2023Quote: Short read WGS libraries for Lg7742a and Lj8627 were prepared from 2µg of HMW gDNA using the Illumina TruSeq DNA PCR-Free kit (Illumina, cat#20015962) and sequenced on an Illumina MiSeq (PE 250bp ...
-
bioRxiv - Evolutionary Biology 2021Quote: Libraries for each individual starling were constructed using a TruSeq DNA PCR-free High Throughput Library Prep Kit (Illumina, San Diego, CA). All individuals passed the initial quality check with FASTQC (Babraham Bioinformatics ...
-
bioRxiv - Genomics 2020Quote: ... sequencing libraries of the two deeply sequenced samples were constructed with 1.8-2 μg sample DNA and the TruSeq DNA PCR-Free kit (Illumina, San Diego, CA). The remaining 74 paired-end short insert (350 nt ...
-
bioRxiv - Genomics 2020Quote: ... Samples were prepared for sequencing using 1 ug of genomic DNA following the TruSeq PCR free kit protocol (Illumina, FC-121-3001). Resulting libraries were quality checked on an Agilent DNA 1000 bioanalyzer (Agilent Technologies ...
-
bioRxiv - Plant Biology 2019Quote: ... one DNA library was prepared using the PCR-free TruSeq DNA sample preparation kit following the manufacturer’s instructions (Illumina, San Diego, CA), and sequenced on an Illumina MiSeq instrument (paired-end 2×250bp ...
-
bioRxiv - Genomics 2019Quote: The PCRfree libraries were constructed using DNA from adult female animals with the Truseq PCR free kit (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol using 1 μg DNA as input ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR-generated amplicon libraries were subjected to 250 nt paired-end sequencing on a MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Genomics 2019Quote: Illumina sequencing libraries for both parents (i.e. sire and dam) and F1 fetus were prepared using TruSeq PCR-free preparation kits (Illumina, San Diego, CA). A total of ∼55x ...
-
bioRxiv - Genomics 2019Quote: ... Multiple shotgun genomic libraries were prepared using Illumina TruSeq DNA PCR-free library preparation kit and Nextera XT sample preparation kit (Illumina Inc., USA) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... the sheared PCR products were processed using a Nextera XT DNA Sample Preparation Kit according to the manufacturer’s instructions (Illumina, San Diego, CA). All the libraries were sequenced at a 2×150 bp read length on an Illumina HiSeq 2000 platform ...
-
bioRxiv - Microbiology 2021Quote: Metagenomic sequencing libraries were constructed by Genome Quebec using an Illumina TruSeq DNA PCR-Free Library Preparation kit (Illumina, Inc., CA, US) with a final size selection of 400 bp ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Genomics 2022Quote: ... a library was prepared from 1 μg of genomic DNA and a TruSeq DNA PCR-free Sample Preparation Kit (Illumina, CA, USA). Paired-end (151 bp per read ...
-
bioRxiv - Genomics 2022Quote: ... USA) for short read sequencing as specified in the TruSeq DNA PCR-Free Reference Guide (Oct 2017, Illumina, San Diego, CA, USA). A library was prepared using a TruSeq DNA PCR-Free library preparation kit according to manufacturer guidance and was sequenced on a NextSeq500 instrument (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Sequence libraries of the V1 and V3 region of the 16S rRNA genes from each of the samples were constructed in accordance with the Dual Barcoded Two-Step PCR procedure from Illumina (Illumina, 2013). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... A single library from these samples (Acerv FL 14120) was prepared using the TruSeq DNA PCR-Free kit (Illumina, San Diego, CA) and the remaining samples were prepared using the TruSeq DNA Nano kit (Illumina) ...
-
bioRxiv - Molecular Biology 2020Quote: ... pooled and then purified using AMPure beads before running index-PCR using the Nextera XT Index Kit (Illumina, San Diego, CA, USA). AmpliSeq libraries were subsequently normalized before sequencing the libraries as 300bp paired-end reads on Illumina MiSeq (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... Genome libraries for short-read sequencing were prepared with the TruSeq DNA PCR-Free Sample Prep Kit (Illumina, San Diego, CA, USA), and sequenced on the NextSeq 500 platform (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Illumina sequencing adapters and dual-index barcodes were added to the purified amplicon products using limited cycle PCR and the Nextera XT Index Kit (Illumina, CA, USA). Amplicons from 96 samples and controls were pooled in equimolar amounts and the resultant libraries were purified by gel extraction and quantified (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... and PCR and sequencing were performed as described previously (2 x 250bp paired-end reads, on an Illumina Miseq (Lemont, IL, USA)) [68–70] ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... although sequence data for each isolate is derived from pools of individuals (except from PCR-free Illumina sequence data for S. avenae), all individuals sequenced for a given isolate are expected to contain the same two haplotypes and so sequence data can be combined to reconstruct fully phased haplotypes for each isolate.
-
bioRxiv - Molecular Biology 2023Quote: ... Agilent 2100 Bioanalyzer and ABI Step One Plus Real-Time PCR System were used following the sequencing on the Illumina HiSeqTM4000 system (Illumina, United States). Illumina sequencing was performed at the Beijing Genomics Institute (BGI-Shenzhen ...
-
bioRxiv - Genomics 2023Quote: ... DNA libraries were synthesised from 3.9 μg of gDNA using the Illumina TruSeq DNA PCR-Free kit (Illumina, San Diego, CA, USA) and sequenced on Illumina NovaSeq 6000 platform (Illumina ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... insert size 550 nt) were constructed from 1.8-2 µg gDNA with the TruSeq DNA PCR-Free kit (Illumina, San Diego, CA) and sequenced on the Illumina HiSeq 2500 by the Genomics Core Facility at Pennsylvania State University ...
-
bioRxiv - Plant Biology 2020Quote: ... A second round of PCR was used to add the dual indices with the Nextra XT Index Kit (Illumina, San Diego, CA, USA). The quality of these sequencing libraries was determined by the Qubit® 2.0 Fluorometer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... A paired-end library was constructed from 1 µg of the DNA using TruSeq DNA PCR-Free LT Sample Prep kits (Illumina K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-qPCR gene expression quantifications were performed using AceQ qPCR SYBR Green Mix (Vazyme Biotech) on Eco Real-Time PCR System (Illumina, San Diego, CA). RNA expression was normalized to a geometric mean of two reference genes ...
-
bioRxiv - Neuroscience 2021Quote: ... with 5 ng input RNA followed by 9 cycles of PCR amplification and library preparation using the Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA). Sequencing was performed on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Plant Biology 2021Quote: ... A paired-end library and four mate libraries were constructed using a TruSeq DNA PCR-Free Library Prep Kit and a Nextera Mate Pair Sample Preparation Kit (Illumina, San Diego, CA), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... DNA libraries for purified PCR amplicons were constructed using an Illumina TruSeq Nano DNA LT Library Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2020Quote: ... we constructed a sequencing library (insert size of 500 bp) with TruSeq DNA PCR-Free Library Prep Kit (Illumina, San Diego, CA, USA) to sequence on HiSeqX (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... Genomic DNA libraries for short- and long-read sequencing were generated with the TruSeq DNA PCR-Free Kit (Illumina, San Diego, CA, USA) and the SMRTbell Express Template Prep Kit 2.0 (PacBio ...