Labshake search
Citations for Illumina :
7851 - 7900 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... NGS was conducted on a NextSeq® 500 (Illumina, SY-415-1001) using the High Output Kit v2.5 (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... using the High Output Kit v2.5 (Illumina, cat.no. 20024906) with 75 cycles of single-end sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were sequenced on the Illumina NextSeq 500 over two NextSeq 500 High Output v2.5 150 cycle kits (Illumina; 20024907) to generate > 25,000 raw reads per cell for each sample ...
-
PRC1 directs PRC2-H3K27me3 deposition to shield adult spermatogonial stem cells from differentiationbioRxiv - Developmental Biology 2023Quote: ... and WT CUT&RUN libraries for H3K4me3 were sequenced on the NextSeq 500 system (Illumina) with paired-ended 75-bp reads.
-
bioRxiv - Immunology 2023Quote: ... The NGS libraries for MiSeq (Illumina, San Diego, CA, USA) were constructed by three-step PCR amplification ...
-
bioRxiv - Immunology 2023Quote: ... for 2 × 250 cycles using MiSeq PE cluster generation kits and MiSeq SBS Kit sequencing reagents (Illumina).
-
bioRxiv - Genomics 2023Quote: ... muscle and liver (Nanopore long reads and Illumina short reads, MNHN ZO-2020-125) or liver (Hi-C ...
-
bioRxiv - Genomics 2023Quote: ... a TruSeq Stranded mRNA Library Kit (Illumina, San Diego, CA) was used for mRNA sequencing and library preparation ...
-
bioRxiv - Genomics 2023Quote: ... These BAM files were quality checked by using systemPipeR’s alignStats function and subsequently a gene reads table was calculated by the summarzieOverlaps function of the GenomicAlignments (29) R/BioConductor package and the corresponding Gene Transfer Format (GTF) file (Illumina’s iGenomes). Normalization and detection of deregulated genes was performed using the DESeq2 v ...
-
bioRxiv - Genomics 2023Quote: ... along with 10 ul of Nextera DNA Flex Dual Index adapters (Illumina: IDT for Illumina DNA/RNA UD indexes ...
-
bioRxiv - Cell Biology 2023Quote: ... before sequencing on a HiSeq2500 System (Illumina). Sequencing reads were mapped to the library using xcalibr and counts were then analyzed with MAGeCK (version 0.5.8 ...
-
bioRxiv - Systems Biology 2023Quote: ... The final library was submitted for sequencing on an Illumina sequencer (different sequencers were used, namely NovaSeq, HiSeq, NextSet, and MiSeq; all from Illumina, San Diego, CA). 50 bp single-end sequencing was performed in all cases to cover the barcode region ...
-
bioRxiv - Zoology 2023Quote: ... Publicly available fastq files from Illumina short read sequencing were downloaded from NCBI and aligned to both the human (GRCh.38 ...
-
bioRxiv - Systems Biology 2023Quote: ... and sequenced on a HiSeq 4000 using a 2×150bp Paired End configuration (Illumina, La Jolla, CA), targeting 50 million paired-end reads per library ...
-
bioRxiv - Zoology 2023Quote: ... where short read (Illumina inc, San Diego) whole genome sequencing data from 30 gorillas was aligned to the NCBI35 (hg17 ...
-
bioRxiv - Systems Biology 2023Quote: ... allowing 4 lanes of 10x to be sequenced per NovaSeq S1 flow cell (Illumina #20028319) using a 28bp read 1 ...
-
bioRxiv - Systems Biology 2023Quote: Sequencing libraries were prepared by tagmenting 10 ng WTA DNA with Nextera XT kit (Illumina #FC-131-1024). Indexing PCR was primed with a nextera i7 index primer (e.g ...
-
bioRxiv - Systems Biology 2023Quote: ... Libraries were pooled evenly sequenced per NovaSeq XP flow cell (Illumina #20043130) using a 28bp read 1 ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Physiology 2023Quote: ... Single-end sequencing with 100-bp read length was conducted on a NovaSeq platform (Illumina, San Diego, CA) by the University of Washington’s Northwest Genomics Center ...
-
bioRxiv - Physiology 2023Quote: ... high-sensitivity spectrofluorometric measurement was poly-A selected and reverse transcribed using Illumina’s TruSeq stranded mRNA library preparation kit (Cat# 20020595; Illumina, San Diego, CA). Each sample was fitted with one of 96 adapters containing a different 8 base molecular barcode for high level multiplexing ...
-
bioRxiv - Plant Biology 2023Quote: ... Two µg of DNA were used to prepare 350-bp insert libraries for 150-bp paired-end sequencing (Novogene Biotech, Beijing, China) on an Illumina HiSeq 2500 system (Illumina, San Diego, USA) using standard Illumina protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... Paired-end sequencing (2 × 150 bp) was conducted on the NovaSeq 6000 (Illumina).
-
bioRxiv - Systems Biology 2023Quote: Following sequencing on a NovaSeq 6000 platform (Illumina) by Novogene ...
-
bioRxiv - Systems Biology 2023Quote: ... the sub-libraries underwent tagmentation using the Nextera DNA Library Preparation Kit (Illumina). The tagmentation process was promptly neutralised using the Monarch PCR & DNA Cleanup Kit (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... High-quality RNA-Seq libraries were sequenced on the NovaSeq 6000 V1.5 platform (Illumina, Gurgaon, India) in paired-end reads (2×150 bp) ...
-
bioRxiv - Physiology 2023Quote: ... and KAPA Library Quant (Illumina) DNA Standards 1-6 (KAPA Biosystems KK4903) ...
-
bioRxiv - Plant Biology 2023Quote: ... Libraries were sequenced on a HiSeq 1500 instrument (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: Raw sequencing data were de-multiplexed with bcl2fastq software (Illumina). FASTQ files were mapped to the TAIR10 genome using STAR with default parameters (Dobin et al ...
-
bioRxiv - Neuroscience 2023Quote: ... Pooled libraries were sequenced on Illumina NovaSeq6000 sequencers with 150-bp paired-end chemistry (Illumina) at the Iowa Institute of Human Genetics (IIHG ...
-
bioRxiv - Neuroscience 2023Quote: ... Ligation with Ribo-Zero Plus (Illumina Inc., San Diego, CA). The KAPA Illumina Library Quantification Kit (KAPA Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Physiology 2023Quote: ... followed by onboard clonal clustering of the patterned flow cell using the NovaSeq 6000 S1 Reagent Kit v1.5 (200 cycle) (Illumina 20028318). A 2x101 cycle sequencing profile with dual index reads is completed using the following sequence profile ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were prepared using the Nextera DNA Library Prep kit (Illumina FC-121-1030) and quality was analyzed using the D1000 ScreenTape Assay (Agilent 5067-5582) ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA libraries were prepared with poly-A selection using the TruSeq Stranded mRNA Library Prep Kit (Illumina 20020594) and paired-end 75 bp sequencing to a depth of ∼50 million reads per sample was performed using the Illumina HiSeq 2500 system at the UCLA Neuroscience Genomics Core.
-
bioRxiv - Neuroscience 2023Quote: Sequencing libraries were prepared with the TruSeq Stranded Total RNA Library Preparation Gold kit (Illumina, San Diego, CA, USA), using 16 PCR cycles for cDNA fragment enrichment ...
-
bioRxiv - Neuroscience 2023Quote: ... Output from Illumina software is processed by the Picard data-processing pipeline to yield CRAM or BAM files containing demultiplexed ...
-
bioRxiv - Neuroscience 2023Quote: ... The libraries were sequenced in an Illumina HiSeq4000 (Illumina, San Diego, CA, USA) with a depth of around 20 Mio reads per sample.
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were prepared using the Illumina TruSeq Stranded mRNA kit (Illumina 20020594). Samples were pooled ...
-
bioRxiv - Pathology 2023Quote: ... The library was sequenced using Illumina technology (Illumina Genome Analyzer IIx System). Library generation and sequencing were performed by the CNIC Genomics Unit under the supervision of Dr ...
-
Juxtacrine DLL4-NOTCH1 signaling between astrocytes drives neuroinflammation via the IL-6-STAT3 axisbioRxiv - Neuroscience 2023Quote: ... Pooled library preparations were sequenced on NextSeq® 500 whole genome sequencing (Illumina®), corresponding to 2×30million reads per sample after demultiplexing ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNAs were prepared using the single cell 30 Protocol as per manufacturer’s instructions and sequenced on a NovaSeq instrument (Illumina) with 26 bases for read 1 and 98 bases for read 2.
-
bioRxiv - Neuroscience 2023Quote: ... DNA was amplified and sequenced by Cellecta with >500 reads/sgRNA according to their NGS prep kit (#LNGS-400) and sequenced on a NextSeq 500 (Illumina). Counts files of DMSO and vincristine -treated samples subject to comparison were input into MAGeCK-including Negative Controls (https://kampmannlab.ucsf.edu/mageck-inc ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were sequenced using a NovaSeq 6000 and FASTQ files were prepared using bcl2fastq (Illumina) and then aligned to the mouse GRCm38/mm10 reference genome using Cellranger (v7.0.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... Integrity of cDNA libraries were assessed with a High Sensitivity DNA Kit on a Bioanalyzer 2100 before samples were sent for 2×150bp paired-end sequencing on an Illumina NovaSeq 6000 (Illumina) at the Interdisciplinary Center for Biotechnology Research (ICBR ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Plant Biology 2023Quote: ... Ltd using the Novaseq 6000 system (Illumina, Inc) with a read length of 2 x 150 bp.
-
bioRxiv - Plant Biology 2023Quote: ... the libraries were diluted to 10 nM and submitted to high-throughput sequencing using the NextSeq 500 system (Illumina) at the IGC Genomics Unit ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA-seq transcriptome libraries were prepared using the TruSeq RNA sample preparation kit from Illumina, and sequencing was performed on an Illumina Novaseq 6000 by Novogene.
-
bioRxiv - Synthetic Biology 2023Quote: ... Base call (.bcl) files for each cycle of sequencing were generated by Illumina Real Time Analysis (RTA ...