Labshake search
Citations for Illumina :
701 - 750 of 863 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... short RNA oligonucleotides were ligated to the ends of the active RNAs to facilitate reverse transcription and PCR needed for sequencing using the TruSeq small RNA library prep kit (Illumina). We adapted the ligation steps to 24h ...
-
bioRxiv - Genomics 2024Quote: Purified PCR products were subject to sequencing library preparation using the Nextera XT Library Prep Kit (Illumina FC-131-1024) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and non-canonical IDH1 mutations and IDH2 mutations using next-generation sequencing (sequence analysis was carried out following PCR enrichment using a QIAseq Targeted DNA custom panel, Germantown, MD, USA and Illumina Next Generation Sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... Libraries were then indexed and PCR amplified (10 cycles) and sequenced on Illumina HiSeq 2500 sequencing platform following the manufacture’s protocols (Illumina, Hayward CA.).Sequence reads were aligned to GRCh37-lite using Burrows-Wheeler Aligner (BWA ...
-
bioRxiv - Genomics 2020Quote: ... The purified PCR reactions were pooled together and then sent for paired-end Illumina MiSeq sequencing (Illumina 2 × 250 v2 kit) at the Edinburgh Genomics Facility (University of Edinburgh ...
-
bioRxiv - Cancer Biology 2021Quote: ... indexed libraries for human whole genome sequencing were constructed from 1.0 µg gDNA using the TruSeq DNA PCR-Free Library Prep Kit (Illumina, San Diego) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Doyle and Doyle 1987) and subjected to PCR (for Sanger sequencing) or rolling-circle amplification with the GE TempliPhi kit (for Illumina sequencing) per the manufacturer's instructions ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplicons were sequenced on an Illumina MiSeq instrument (v2 chemistry, 150 bp paired end reads) (Illumina, San Diego, CA, USA). Data were analyzed using a custom-built pipeline ...
-
bioRxiv - Plant Biology 2020Quote: ... TruSeq PCR-Free Low Throughput libraries were prepared for each DNA sample following the manufacturer’s instructions (Illumina, San Diego, CA, USA). Each sample had a unique index from Illumina TruSeq DNA CD Indexes (96 indexes/samples) ...
-
bioRxiv - Biochemistry 2020Quote: ... Sheared DNA was used to construct the library using the Illumina TruSeq DNA PCR-Free Low Throughput Library Prep Kit (Illumina, 20015962). After adapter ligation ...
-
bioRxiv - Plant Biology 2020Quote: ... The sequencing step of PCR fragments was done on an Illumina Miseq personal sequencer using the MiSeq Reagent Kit v3 (Illumina®) followed by quality control processes for libraries using the PippinHT system from SAGE Sciences for libraries purification ...
-
bioRxiv - Cell Biology 2022Quote: ... Purified tagmented DNA was amplified with KAPA HIFI polymerase (12 PCR cycles) and Unique Dual Primers from Illumina (Cat number 20332088). Size-selection (L:1.1 ...
-
bioRxiv - Microbiology 2022Quote: ... 1 µg of gDNA per sample was analyzed using the TruSeq® DNA PCR-Free Low-Throughput Library Prep Kit (Illumina) according to the manufacturer’s directions ...
-
bioRxiv - Immunology 2020Quote: ... The second round PCR (8 cycles, 70°C annealing temperature) was performed using Nextera XT index primers (Illumina, FC-131-2001) which introduce 8 base pair indices on the 5’ and 3’ termini of the amplicon for data demultiplexing of each sample screened ...
-
bioRxiv - Microbiology 2020Quote: ... PCR-generated amplicon libraries were subjected to 250 nt paired-end sequencing on a MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2021Quote: Short-read paired-end sequencing of DNA and rRNA-depleted samples was performed on the Illumina Novaseq platform (S prime, 2x 150 bp) using TruSeq PCR free DNA library preparation kit (Illumina Inc.).
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Evolutionary Biology 2020Quote: ... 500 ng of the purified and pooled PCR genome amplicons were prepared for sequencing via Nextera DNA Flex Kit (Illumina, #20018705) with 96 indexes (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the above elute as template ...
-
bioRxiv - Microbiology 2021Quote: ... A 50µl aliquot of the final pooled PCR product was sequenced at the UC Davis Genome Center DNA Technologies Core via the Illumina MiSeq PE250 platform (Illumina, CA).
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... RNA fragmentation was performed at 94°C for 6 minutes and 10 PCR cycles were used during library amplification with TruSeq single-index adapters (Illumina, #20020492). Final library concentrations were quantified with both Qubit fluorometric quantification (DNA dsDNA HS kit ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1.1 micrograms of extracted DNA was utilized as starting material for TruSeq DNA PCR-Free library preparation kit (Illumina Inc., USA). The DNA was fragmented using focused ultrasonicator (Covaris M220 ...
-
bioRxiv - Genetics 2021Quote: 5× HOT FIREPol® EvaGreen® qPCR Mix Plus with ROX (Solis Biodyne) and an Eco Real-Time PCR System (Illumina) were used for qPCR ...
-
bioRxiv - Genomics 2021Quote: PCR-free Illumina libraries were generated from 1 μg genomic DNA using a Covaris LE220-plus to shear the DNA and the TruSeq® DNA PCR-Free HT Sample Preparation Kit (Illumina) for library generation ...
-
bioRxiv - Genomics 2020Quote: ... the fragmented amplicons were cleaned-up and amplified by 5 cycles of PCR using specific index adapters for Illumina sequencing (Nextera™ DNA CD Indexes, Illumina) (Supplementary Figure 1B) ...
-
bioRxiv - Immunology 2022Quote: ... The PCR product library was quantitated and subjected to sequencing on an Illumina MiSeq sequencer (Illumina, San Diego, CA 92122 USA). HLA alleles and genotypes were called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Bioengineering 2022Quote: ... The primers T7_Endo_Lib_LONG_FOR GCCCTCTGTGTGAATTCT and T7_Endo_Lib_LONG_REV GTCACCGACACAAGCTTA were used and a second round of PCR was carried out with the IDT for Illumina UD indexes (Illumina Corp.) to add adapter tags ...
-
bioRxiv - Genomics 2022Quote: ... After purifying the Sample Tag PCR1 product indexing PCR was done following instructions of the MULTI-seq protocol where small RNA TrueSeq indexing primers (Illumina #15004197) were used for i7 and the Forward Primer from the BD WTA kit was used for i5.
-
bioRxiv - Immunology 2022Quote: ... multiplex PCR was used to amplify rearranged VDJ sequences followed by high throughput sequencing using Illumina technologies (Illumina, San Diego, CA). PCR amplification bias was minimized by internal controls in the ImmunoSEQ assay29 ...
-
bioRxiv - Microbiology 2022Quote: ... TraDIS adapters were used for adapter ligation and PCR amplified for final library construction using the Nextera XT DNA kit (Illumina, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Illumina sequencing adapters and dual index barcodes were added to each library using an Index PCR (Illumina XT Index Kit v2) followed by PCR clean-up with AMPure beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2023Quote: ... The DNA was sent for library construction with TruSeq DNA PCR-free library prep kit with 350-bp insert (Illumina, USA) prior to sequencing with Illumina HiSeq 2500 platform on rapid run mode generating 2×250 bp (Macrogen Inc ...
-
bioRxiv - Immunology 2022Quote: ... and PCR products were sent to the @BRIDGe platform for sequencing on an Illumina MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... the index PCR step was performed as in the protocol except using IDT for Illumina DNA/RNA UD Indexes Set A (Illumina, 20027213), MyFi Mix (BIOLINE ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were then indexed and PCR amplified (10 cycles) and sequenced on Illumina HiSeq 2500 sequencing platform following the manufacture’s protocols (Illumina, Hayward CA).
-
bioRxiv - Plant Biology 2023Quote: Short read WGS libraries for Lg7742a and Lj8627 were prepared from 2µg of HMW gDNA using the Illumina TruSeq DNA PCR-Free kit (Illumina, cat#20015962) and sequenced on an Illumina MiSeq (PE 250bp ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified tagmented DNA was amplified with KAPA HIFI polymerase (12 PCR cycles) and Unique Dual Primers from Illumina (Cat number 20332088). Size-selection (L:1.1 ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries for whole-genome sequencing (WGS) were built using a TruSeq DNA PCR-Free Low Throughput Library Prep Kit (Illumina, USA) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR-amplified libraries were quantified on a Bioanalyser and appropriately diluted and multiplexed for deep sequencing (Illumina MiSeq 2×75 bp).
-
bioRxiv - Genomics 2023Quote: ... and Illumina PCR-free libraries with insert sizes of 350-bp were constructed using Truseq Nano DNA HT Sample preparation Kit (Illumina USA). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... Equal amounts of PCR product (2 µl 4nM) were pooled and sequenced on an Illumina MiSeq Sequencer (Illumina, San Diego, USA) using a paired-end 300bp V3 kit at Utrecht Sequencing Facility (www.useq.nl).
-
bioRxiv - Plant Biology 2023Quote: ... The libraries were prepared using the TruSeq DNA PCR-Free kit and sequenced on the HiSeq RR-PE100 system (Illumina, USA). This resulted in approximately 188 million reads in total or about 94 million reads per pooled sample ...
-
bioRxiv - Systems Biology 2023Quote: ... Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712) as follows:
-
bioRxiv - Systems Biology 2023Quote: ... Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712). The sequences for the primer sets were used for the libraries cloned into pRDA-052 or pRDA-550 are listed below:
-
bioRxiv - Biophysics 2023Quote: ... We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the elute as template ...
-
bioRxiv - Genetics 2022Quote: ... and hMT-2_R (GGCAGGTCAATTTCACTGGT)] and the library preparation of the LR-PCR products of hMT1 and hMT2 primers was conducted using DNA Prep Tagmentation (Illumina Inc.). This approach allows the fragment size of the tagmented LR-PCR products to be evenly 300 bp ...
-
bioRxiv - Genetics 2022Quote: ... Library preparation of the LR-PCR products was performed using a Nextera XT DNA Library Preparation Kit (Illumina Inc., CA, USA). For 96 Sudanese samples ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR product library was quantitated and subjected to sequencing on an Illumina MiSeq sequencer (Illumina, San Diego, CA 92122 USA). HLA alleles and genotypes were called using the Omixon HLA Explore (version 2.0.0 ...