Labshake search
Citations for Illumina :
601 - 650 of 863 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: The second stage PCR procedure attached unique index primers to each sample using the Nextera XT v2 set A kit (Illumina). Purified DNA (5 μl ...
-
bioRxiv - Evolutionary Biology 2021Quote: We prepared the Illumina sequencing libraries by performing two consecutive rounds of PCR following the approach of Fluidigm System (Access ArrayTM System for Illumina Sequencing Systems ...
-
bioRxiv - Cancer Biology 2020Quote: ... Single cell barcoded cDNA libraries were quantified by quantitative PCR (Kappa Biosystems) and sequenced on an Illumina NextSeq 500 (Illumina). Read lengths were 26 bp for read 1 ...
-
bioRxiv - Microbiology 2021Quote: ... DNA libraries preparation with 16 cycles of PCR amplification and sequencing were done following manufacturer instructions (TruSeq ChIP-Library kit, NextSeq 500/550, Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... The sequencing library was generated by PCR and used to produce the clusters thereafter sequenced on NovaSeq 6000 System (Illumina). Each sample was sequenced in a separate flow cell lane ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were prepared from 100 ng of DNA with the TruSeq DNA PCR-Free library Prep Kit from Illumina and sequenced on Illumina MiSeq platform with 150-bp paired-end read lengths (Institut Pasteur ...
-
bioRxiv - Neuroscience 2020Quote: ... then the second-stage PCR was performed to attach Illumina i7 and i5 indexes (Illumina Nextera XT Library Preparation Kit) to individual samples ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Cancer Biology 2022Quote: ... performed the library preparation for WGS of parental and resistant cells of cell lines #3 and #9 as well as a control tail samples corresponding to line #3 with the TruSeq DNA PCR-free Kit (Illumina) and the 150 bp paired-end sequencing on a HiSeq X (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... resistant and P12 cells of cell lines #3 and #9 was performed at the Genomics and Proteomics Core Facility of the German Cancer Research Center (GPCF DKFZ, Heidelberg) using the TruSeq DNA PCR-free Methyl protocol (Illumina) for library preparation ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were prepared from 100 ng of DNA with the TruSeq DNA PCR-Free library Prep Kit from Illumina and sequenced on Illumina MiSeq platform with 150-bp paired-end read lengths (Institut Pasteur ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina HiSeq2500 in 50bp single-read mode.
-
bioRxiv - Developmental Biology 2020Quote: ... A paired-end library with an average insert size of 450 bp was constructed with a TruSeq DNA PCR-free Library Prep Kit (Illumina) and two different mate-pair libraries (3 kb and 5 kb ...
-
bioRxiv - Molecular Biology 2021Quote: ... The generated cDNA was 3′ end-adenylated and ligated to Illumina Paired-end sequencing adapters and amplified by PCR using HiSeq SR Cluster Kit v4 cBot (Illumina). Libraries were analyzed on a 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: To the cancer hot spot library P5 and P7 sequences were attached by PCR using the custom pBB9 primer and Nextera N701 (Illumina). Library was purified with 0.6x volume fraction AMPure beads ...
-
bioRxiv - Molecular Biology 2020Quote: ... Pools were sent to the University of Geneva for sequencing Illumina (MiSeq) where sequencing libraries were prepared using the reagents of the PCR-free TruSeq kit (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... colonies were tested for their sensitivity to streptomycin and mutants were confirmed by PCR across the deleted region and further verified by Illumina sequencing.
-
bioRxiv - Molecular Biology 2020Quote: ... The generated cDNA was 3′ end-adenylated and ligated to Illumina Paired-end sequencing adapters and amplified by PCR using HiSeq SR Cluster Kit v4 cBot (Illumina). Libraries were analyzed on a 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... Analysis of the screen is as follows: the sequences flanking retroviral insertion sites were determined using inverse PCR followed by Illumina sequencing ...
-
bioRxiv - Genetics 2020Quote: Nextera barcode adapters were added to can1 amplicons and were then minimally PCR amplified (8 cycles) for attachment of Illumina Nextera XT index primers set A (Illumina). After PCR ...
-
bioRxiv - Genetics 2021Quote: ... 700 ng of genomic DNA was sheared to an average size of 400 bp using a Covaris LE220 and was used as input to generate a whole-genome library using the TruSeq PCR-free kit (Illumina). The resulting DNA libraries were sequenced on Illumina Hi-seq X instrument to generate 2×150bp paired-end reads.
-
bioRxiv - Genomics 2021Quote: ... Bisulfite-treated DNA samples (50 ng) were subjected to 10 cycles of PCR using random primers from the TruSeq DNA Methylation Kit (Illumina) to add adapters ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and subjected to a second PCR to introduce dual index sequences using Nextera XT Index Kits (Illumina, San Diego, CA). In the second PCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... The sgRNA composition of the population from each replicate was PCR amplified and barcoded followed by next-generation sequencing on a MiSeq (Illumina) using 150-cycle ...
-
bioRxiv - Genomics 2021Quote: ... of Korea) for library preparation with 350 bp targeted insert size using TruSeq DNA PCR Free preparation kit (Illumina, USA) and sequencing on HiSeq X device (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... 25 mL of 2x NEBNext Ultra II Q5 Master Mix, 3 mL of 10 mM Universal PCR primer from Illumina, 3 mL of 10mM Index PCR primer and 9 mL of nuclease-free water and amplified for 10 cycles (98C for 10 s ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Subsequent to second round PCR amplification MiSeq sequencing libraries were generated using Nextera XT DNA Sample Preparation Kits (Illumina, Inc.). Amplicons for each sample were tagged using Nextera XT Index Kits (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Purified PCR products were combined in equimolar concentrations and sequenced on an Illumina MiSeq (Miseq Reagent Kit V2, 50-cycle; Illumina) using primer PLM49 ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were processed for WGS using multi-segment PCR [10] and then prepared for deep sequencing using the Nextera XT library preparation reagent (Illumina). Samples were sequenced on the Illumina NextSeq platform ...
-
bioRxiv - Immunology 2020Quote: ... The transposed DNA was amplified by PCR for 10-12 cycles by using the Nextera DNA Library Preparation Kit and Nextera XT Indexing Kit (Illumina). The library DNA within the 150-to 500-bp range was enriched by AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Immunology 2020Quote: ... First strand cDNA was subjected to limited PCR amplification followed by Tn5 transposon-based fragmentation using the Nextera XT DNA Library Preparation Kit (Illumina). Samples were then PCR amplified for 12 cycles using barcoded primers such that each sample carries a specific combination of eight base Illumina P5 and P7 barcodes for subsequent pooling and sequencing ...
-
bioRxiv - Immunology 2020Quote: ... the 2nd SGA env PCR products were cleaved into approximately 300 bp products by tagmentation using the Nextera DNA Library Prep Kit (Illumina). Indices from the Nextera Index Kit (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared following the RNA-seq sample work flow using the Scriptseq Complete kit for bacteria and indexed with unique Scriptseq Index PCR primers (Illumina).
-
bioRxiv - Genomics 2021Quote: ... Genomic DNA library was prepared and sequenced using a TruSeq DNA PCR-Free Library Prep Kit (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2021Quote: ... DNA was PCR amplified for a total of 11-13 cycles using barcoded primers (Illumina Nextera XT Index Kit v2) and purified using Ampure beads (1.4:1 beads:sample ratio) ...
-
bioRxiv - Genomics 2021Quote: ... Direct tagmentation of the mRNA/cDNA hybrids and PCR amplification were performed on beads using Nextera XT DNA Library Prep Kit (Illumina); the Reference Guide was followed exactly for 20K and 10K samples ...
-
bioRxiv - Genomics 2020Quote: ... The products were then amplified by 12 cycles of PCR using specific index adapters for Illumina sequencing (Nextera XT Index Kit v2, Illumina) (Supplementary Figure 1A) ...
-
bioRxiv - Genetics 2020Quote: ... Two PCR-free libraries with insertion sizes of 350 bp and 550 bp were constructed for each cat using the TruSeq DNA PCR Free library preparation kit (Illumina). The Illumina HiSeq 2000 (Illumina ...
-
bioRxiv - Genomics 2021Quote: Final samples for both inverse PCR and UMI-amplicons (concentration 4 nM) were sequenced as paired-end reads on HiSeq2500 and NextSeq500 sequencers (Illumina).
-
bioRxiv - Genomics 2022Quote: ... The DNA fragments cut by the enzyme were amplified by PCR and then sequenced with 2X150 bp chemistry on the Illumina HiSeq X Ten platform (Illumina).
-
bioRxiv - Genomics 2022Quote: Whole-genome shotgun libraries of 13 Capsicum lines were prepared with the TruSeq DNA PCR-Free Sample Prep Kit (Illumina), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Purified DNA was further amplified by PCR using Kapa Hifi Hotstart Ready Mix with Nextra XT Index Primers from Nextra XT Index Kit (Illumina). The PCR condition was ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were indexed using the Nextera XT Index Kit following the manufacturer’s instructions (Illumina, San Diego, CA, USA) and the concentration of the differently indexed samples determined using a KAPA Library Quantification Complete kit (Kapa Biosystems ...
-
bioRxiv - Microbiology 2022Quote: Both the PCR products from all the four cohorts were bead purified and subjected to another round of PCR with dual indices and adapters to generate the respective libraries as recommended by Illumina. The cleaned libraries were quantitated on Qubit® flurometer and appropriate dilutions loaded on a D1000 screen tape to determine the size range of the fragments and the average library size ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA was then subjected to PCR to target the 16S V3-V4 region and to generate the libraries as recommended by Illumina MiSeq sequencing (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR reactions were performed using the Thunderbird® SYBR qPCR mix (TOYOBO) and Eco Real-Time PCR System (Illumina). The PCR primers used are listed in Supplementary Table S8 ...
-
bioRxiv - Physiology 2022Quote: ... Multiplexing was conducted by ligating an 8-base molecular barcode to sequences before 15 cycles of PCR amplification and HiSeq 2500 (Illumina) Rapid Mode library sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR product was used to construct libraries and sequenced on an Illumina NovaSeq 6,000 (Illumina, San Diego, CA, USA) with 150 bp paired-end reads ...
-
bioRxiv - Cell Biology 2024Quote: ... At least 200□pg of amplified cDNA were used for tagmentation reaction and subsequent PCR amplification using the Nextera XT kit (Illumina) to construct sequencing libraries ...
-
bioRxiv - Immunology 2024Quote: ... two extra PCR cycles were performed and full length cDNA equally spilt for short-read gene expression library generation (Illumina) and targeted V(D)J capture followed by long-read library generation (Oxford Nanopore Technologies ...