Labshake search
Citations for Illumina :
7051 - 7100 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The library preparations and paired-end sequencing (HiSeq2500, Illumina) were performed as detailed previously (29) ...
-
bioRxiv - Microbiology 2023Quote: ... RNA sequencing was performed following ribosomal RNA depletion and cDNA libraries preparation on an NovaSeq platform (Illumina) with paired-end 150bp (Genewiz-Azenta ...
-
bioRxiv - Microbiology 2023Quote: ... Next-generation sequencing of amplified regions was performed on Illumina® MiSeq TM (Illumina, San Diego, CA, USA) with 2 x 300 bp paired-end configuration at the Laboratorio Nacional de Genómica para la Biodiversidad (UGA-Langebio ...
-
bioRxiv - Microbiology 2023Quote: The prepared libraries were sequenced (2×100 bp paired-end sequencing) on the HiSeq 2500 (Illumina) platform ...
-
bioRxiv - Microbiology 2023Quote: ... as determined by Illumina GenomeStudio software ...
-
bioRxiv - Microbiology 2023Quote: ... The Infinium MethylationEPIC BeadChip Kit (850K) (Illumina, San Diego, CA, USA) was used for a genome-wide methylation profiling to determine the DNA methylation status of >850,000 CpG sites76 ...
-
bioRxiv - Microbiology 2023Quote: ... Directional libraries were prepared using the TruSeq Stranded mRNA Sample preparation kit following the manufacturer’s instructions (Illumina). Libraries were checked for quality on DNA 1000 chips (Bioanalyzer ...
-
bioRxiv - Microbiology 2023Quote: ... followed by library generation using the NEBNext Ultra II DNA Library Prep Kit (Illumina), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Sequencing libraries were prepared from WTA product using Nextera XT (Illumina). After library construction ...
-
bioRxiv - Microbiology 2023Quote: ... amplicon sequence libraries were prepared using the Nextera XT DNA library preparation kit (Illumina, San Diego, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Sample libraries were sequenced on an Illumina MiSeq platform (Illumina Inc., UK) using the MiSeq Reagent Kit v3 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... using the MiSeq Reagent Kit v3 (Illumina) and paired-end 300bp chemistry ...
-
bioRxiv - Microbiology 2023Quote: ... with an Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus Kit (Illumina). Sample quality was ensured using an Agilent Bioanalyzer 2100 or Advanced Analytical Fragment Analyzer ...
-
bioRxiv - Microbiology 2023Quote: ... Library preparation was performed according to the library preparation protocol (TruSeq® Stranded total RNA Reference Guide, Illumina (1000000040498)) with an Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus Kit (Illumina) ...
-
bioRxiv - Immunology 2023Quote: ... RNA-seq libraries were generated from 5 ng of RNA with the SMART-Seq v4 Ultra Low Input RNA Kit from Takara Bio (#634889) and the DNA Prep Kit from Illumina (#20060060) and were clustered and sequenced using an Illumina NovaSeq 6000 instrument ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were constructed using NEB polyA RNA ultra II and subsequently subjected to 150 cycles of sequencing on NovaSeq-6000 (Illumina). Adapters were trimmed using Cutadapt (v2.3) ...
-
bioRxiv - Microbiology 2023Quote: ... 43 genomes were sequenced using a 150-bp paired-end run from Illumina NovaSeq 6000 platform ...
-
bioRxiv - Neuroscience 2023Quote: ... The amplified cDNA was used to construct an Illumina sequencing library and sequenced on a single lane of a NovaSeq 6000 (Illumina). For FASTQ generation and alignments ...
-
bioRxiv - Neuroscience 2023Quote: ... The libraries were sequenced on NovaSeq6000 (Illumina) in paired-end following the manufacturer’s protocol for dual indexing ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA library preparation with oligo-dT primers following the Illumina TruSeq stranded mRNA sample preparation guide (Illumina, San Diego, CA), and sequencing procedure with Illumina HiSeq 3000 platform with 30-50x106 bp reading depth were previously described in detail 19 ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA libraries for RNA-seq were prepared using a Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... Genome sequencing of bacteriophages and bacterial isolates was carried out using a paired end approach (2 × 150 bp) on iSeq100 and Miseq platform (Illumina) respectively ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA-seq transcriptome libraries were constructed using the TruSeqTM RNA sample preparation kit (Illumina, San Diego, CA, USA) with a total of 2 µg RNA ...
-
bioRxiv - Genomics 2023Quote: Further validation of the mitogenome sequence was performed by Illumina reference short reads ...
-
bioRxiv - Genomics 2023Quote: ... lapponica using a Nextera DNA Flex kit with Nextera DNA CD indexes (Illumina). Each library was constructed with 500ng of starting material ...
-
bioRxiv - Genomics 2023Quote: Quality-based read trimming was performed to remove poor-quality reads and contaminating adapter sequences using trimmomatic v.0.39 (Bolger et al., 2014) (parameters: ILLUMINACLIP:Illumina-adapters.fa:2:30:10 SLIDINGWINDOW:10:20 MINLEN:50) ...
-
bioRxiv - Genomics 2023Quote: ... Following sequencing to at least 20 million reads on a NovaSeq platform (Illumina), reads were processed following the ENCODE pipeline (https://github.com/ENCODE-DCC/rna-seq-pipeline) ...
-
bioRxiv - Genomics 2023Quote: ... and used for standard poly(A)+ selection and library preparation with the TruSeq kit (Illumina). Following sequencing to at least 20 million reads on a NovaSeq platform (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... a pilot sequencing was done on Illumina MiSeq Nano platform (Illumina, San Diego, CA, USA). The libraries were sequenced on an Illumina NovaSeq 6000 platform (S Prime flow cell ...
-
bioRxiv - Genomics 2023Quote: ... as per manufacturer’s instructions and the resulting libraries were paired-end sequenced on a NextSeq500 platform (Illumina) to obtain at least 107 reads ...
-
bioRxiv - Genomics 2023Quote: ... Following sequencing on a NovaSeq platform (Illumina), Hi-C reads were aligned to the reference genome GRCh38 using bwa mem (v0.7.17 ...
-
bioRxiv - Genomics 2023Quote: ... FASTQ files were created and demultiplexed using bcl2fastq v2.17.1.14 Conversion Software (Illumina). Deep sequencing was performed by the Roy J ...
-
bioRxiv - Genomics 2023Quote: ... Indexed amplicons were then generated using a Nextera XT DNA Library Prep Kit (Illumina) quantitated ...
-
bioRxiv - Genomics 2023Quote: ... High Sensitivity D1000 tape and then sequenced on a NextSeq 500 sequencer (Illumina) using a 75-cycle High Output kit using a custom read1 primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC) ...
-
bioRxiv - Genomics 2023Quote: Metagenomic DNA libraries were prepared at the time of the outbreak investigation in 2020 for Peach enrichments using the Illumina DNA prep method according to the manufacturer’s specifications (Illumina, CA, USA). Sequencing was performed on a NextSeq 550 with 2 × 150 cycles using the NextSeq 500/550 v2.5 High Output Kit (150 Cycles) ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were then sequenced on an Illumina NovaSeq instrument (Illumina, San Diego, CA, USA), using 250 base-length read chemistry in a paired-end mode ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing was done on the NovaSeq6000 system (Illumina) using a paired-end 2×75 bp protocol ...
-
bioRxiv - Genomics 2023Quote: Metagenomic DNA libraries were prepared at the time of the outbreak investigation in 2017 for Papaya enrichments using the Nextera XT Library Prep according to the manufacturer’s specifications (Illumina, CA, USA). Sequencing was performed on a NextSeq 550 with 2 × 150 cycles using the NextSeq 500/550 v2.5 High Output Kit (150 Cycles) ...
-
bioRxiv - Genomics 2023Quote: Genomic short-read libraries were sequenced on a NextSeq 500 instrument (Illumina) with a NextSeq High Output v2 300 Cycle Kit ...
-
bioRxiv - Genomics 2023Quote: ... Initial library construction for the isolates entailed tagmentation via the Nextera XT DNA library preparation protocol (Illumina). Isolates were initially sequenced on a HiSeq 3000 (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... by the University of Wisconsin-Madison Biotechnology Center (Madison, WI, USA) as specified in the TruSeq DNA PCR-Free Reference Guide (Illumina, San Diego, CA, USA) [17] ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were sequenced on a HiSeq X10 (Illumina), generating 150bp paired reads (minimum average coverage 10X).
-
bioRxiv - Genomics 2023Quote: ... Single-indexed libraries were sequenced 50 nt single end reads on a HiSeq 2500 (Illumina) getting a minimum of 14 millions reads per sample ...
-
bioRxiv - Genomics 2023Quote: ... The dual-indexed libraries were sequenced 50 nt paired end reads on a NovaSeq 6000 (Illumina) getting a minimum of 25 millions reads per sample ...
-
bioRxiv - Developmental Biology 2023Quote: ... using the HiSeqX platform (Illumina, USA) with 150bp paired-end sequencing.
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA of 1μg was used to generate libraries using of Illumina stranded total RNA prep with Ribo-Zero Plus library preparation kit (Illumina, 20040529). The Qubit dsDNA HS (High Sensitivity ...
-
bioRxiv - Cell Biology 2023Quote: ... at least 50 ng/μl of purified RNA for each replicate was sent to Novogene (Sacramento, CA) for cDNA library preparation and Illumina sequencing (Illumina NovaSeq 6000). For Nanopore sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... A NextSeq 500 sequencer (Illumina, San Diego, CA) was used to do paired-end deep sequencing (2X 150 bp ...
-
bioRxiv - Biochemistry 2023Quote: Sequencing libraries were prepared using a Nextera XT DNA Library Preparation kit (Illumina). Libraries were deep sequenced by the Vanderbilt Technology for Advanced Genomics (VANTAGE ...
-
bioRxiv - Genomics 2023Quote: ... and dual-indexed libraries were sequenced 150 nt paired end reads on a NovaSeq 6000 (Illumina) getting a minimum of 25 millions reads per sample ...