Labshake search
Citations for GE Life Sciences :
1351 - 1400 of 4074 citations for Recombinant Human Programmed Cell Death 1 Ligand 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... Cells were centrifuged in Percoll (GE Healthcare) gradient and seeded on Collagen type 1 (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... blood was diluted 1:1 in PBS and isolated by a Ficoll (GE Healthcare, Fisher Scientific) density gradient separation performed at 800 g for 30 minutes at RT ...
-
bioRxiv - Immunology 2020Quote: ... The sensograms were fit in a 1:1 binding model with BIA Evaluation software (GE Healthcare). For epitope mapping ...
-
bioRxiv - Cell Biology 2021Quote: ... incubated for 1 hour with a secondary antibody anti-Mouse (GE Healthcare, NA9310, 1:5000 dilution), washed three times with TBS-Tween 1 % solution and revealed with an ECL Western blotting detection kit (Advansta ...
-
bioRxiv - Biochemistry 2020Quote: ... HyClone™ DMEM/F-12 (1:1; w/o phenol red) was purchased from GE Healthcare Life Sciences (Logan ...
-
bioRxiv - Immunology 2022Quote: ... at a 1:1 ratio and underlaid with 15 mL of Ficoll-Paque Plus (GE Healthcare). Tubes were centrifuged at 800g for 20 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... for γ-H2A - anti-rabbit (1:2000 in 1% milk/PBS-T, GE Healthcare, code NA934V); for EF1-α - anti-mouse (1:10,000 in 1% milk/PBS-T ...
-
bioRxiv - Microbiology 2024Quote: ... for EF1-α - anti-mouse (1:10,000 in 1% milk/PBS-T, GE Healthcare, code NA931V). Following secondary incubation ...
-
bioRxiv - Bioengineering 2021Quote: ... pGEX-4T-1 (GE Healthcare, USA), pET-hmCA (9) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 x 20 mL (GE Healthcare) on an ÄKTA pure protein purification system (Cytiva ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-rabbit (1:5000, GE Healthcare) or anti-rat horseradish peroxidase–conjugated secondary antibodies (1:1000 ...
-
bioRxiv - Biochemistry 2021Quote: ... or pGEX-6P-1 (GE Healthcare) and transformed in One Shot OmniMAX 2 T1R Chemically Competent E ...
-
bioRxiv - Plant Biology 2021Quote: ... or pGEX-4T-1 (GE Healthcare) respectively ...
-
bioRxiv - Biochemistry 2022Quote: ... and pGEX-4T-1 (GE Healthcare) vectors ...
-
bioRxiv - Plant Biology 2022Quote: ... and pGEX-4T-1 (GE healthcare) vectors for prokaryotic expression in E ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1% penicillin–streptomycin (GE Healthcare). For transfection experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGEX-6P-1 (GE Healthcare) vectors ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-rabbit (1:5000, GE Healthcare), or anti-rat horseradish peroxidase–conjugated secondary antibodies (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 x 20 mL (GE Healthcare) on an ÄKTA pure protein purification system (Cytiva ...
-
bioRxiv - Immunology 2021Quote: ... and mononuclear cells were enriched from tumor-derived cell suspensions by 40%/80% Percoll (GE Healthcare GE17-0891-01) density gradient ...
-
bioRxiv - Cell Biology 2021Quote: ... were imaged using a fully automated laser-scanning confocal cell imaging system (IN Cell Analyzer 6500HS, GE Life Sciences) with a NIKON 20X/0.75 ...
-
bioRxiv - Immunology 2020Quote: ... Cell suspensions were filtered through 70μm strainer and immune cells were isolated using Percoll gradient (GE Healthcare Life Sciences). For blood samples ...
-
bioRxiv - Plant Biology 2019Quote: ... and electrotransfered (2 h at 80 V or 16 h at 30 V and 4°C) onto polyvinylidene difluoride membrane (Amersham, GE Healthcare). The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen) ...
-
bioRxiv - Biophysics 2021Quote: ... the sample was concentrated to 2 mL and loaded onto a HiPrep 16/60 Sephacryl S-300 HR column (GE Healthcare) equilibrated and run in Sizing Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... The clarified cell lysates were incubated for 2 h on a spinning wheel at 4°C with 100µl of StrepTactin Sepharose High Performance beads (#28935599, GE Healthcare, USA). Beads were collected by centrifugation (1600 g for 5 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... were incubated with GST or GST-tagged angulin-1 cytoplasmic region (409-575 aa or 409-570 aa) for 2-3 h at 4°C and further incubated with Glutathione Sepharose 4B beads (GE Healthcare) for 1 h at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: Proteins (200 μl at 2 μM) were separated on a Superdex 200 Increase 10/300 GL column (GE Healthcare Life Sciences) equilibrated in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PAGE gel was exposed to a phosphosimage screen for ∼2 hours and analyzed using a Amersham Typhoon imaging system (GE Healthcare). Band intensities corresponding to the uncleaved ribozymes and the two products of self-scission were analyzed using ImageQuant (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then the mixture was centrifuged for 2 mins and the supernatant was desalted by filtration with a Sephacryl S-400 HR column (GE Healthcare), centrifuged at 16 krpm ...
-
bioRxiv - Developmental Biology 2019Quote: ... A total of 96 fractions were collected in a row-wise snaking pattern into a Whatman 2 ml 96-well plate (GE Healthcare), which were then concatenated non-sequentially into a final 24 fractions for proteomic analysis ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein was loaded at concentrations ranging from 2 to 16 mg/ml on a Superdex 200 10/300 GL column (GE Healthcare) equilibrated in 20 mM HEPES ...
-
bioRxiv - Molecular Biology 2019Quote: ... Stoichiometric amounts of each core histone were incubated together under high salt conditions (2 M NaCl) and the resulting histone octamer purified using a Superdex 200 gel filtration column (GE Healthcare). Purified 147bp DNA carrying the 601 nucleosome-positioning sequence was a kind gift from the Brockdorff lab ...
-
bioRxiv - Biochemistry 2019Quote: ... the purified sample was concentrated to 2 mL and loaded onto a HiPrep 16/60 Sephacryl S-300 HR column (GE Healthcare) equilibrated and run in Sizing Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were concentrated to 2 mL and further purified by size-exclusion chromatography using HiLoad 16/600 Superdex 200 (Ge healthcare).
-
bioRxiv - Biochemistry 2021Quote: ... The purified protein was then concentrated to 2 mL and purified by FPLC sizeexclusion chromatography using a Superdex 75 10/300 GL (GE Healthcare) column into 20 mM NaPO4 150 mM NaCl pH 7.5 ...
-
bioRxiv - Bioengineering 2020Quote: ... The ligase was inactivated with 2 M NaCl and the sample was injected into a Sephacryl S-1000 size exclusion column (GE Healthcare) to remove excess oligos and DNA ligase.
-
bioRxiv - Bioengineering 2020Quote: Binding of SARS-CoV-2 RBD to ACE2 –Fc and ACE2mod–Fc fusion proteins were measured using a Biacore T200 instrument (GE Healthcare). Fusion proteins were first immobilized at a coupling density of ∽1000 response units (RU ...
-
bioRxiv - Neuroscience 2020Quote: ... 150 mM NaCl) containing 5% skim milk (Meiji) and subjected to primary antibody for 2 h and HRP-conjugated secondary antibody (GE Healthcare) for 30 min ...
-
bioRxiv - Biophysics 2021Quote: ... The flow through containing SARS-CoV-2 Mpro was collected and further purified using size exclusion chromatography column (G-100, GE Healthcare,) equilibrated with 20 mM Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... myogenic differentiation was induced by replacing the medium with differentiation medium (DM) consisting of DMEM supplemented with 2% horse serum (GE Healthcare) and PS ...
-
bioRxiv - Biochemistry 2020Quote: ... The cleaved protein was separated from any His6-tagged species by passage through the Ni+2-NTA HisTrap HP column and purified further using size-exclusion chromatography (Superdex S75, GE Healthcare). This also served to exchange the protein in a buffer optimized for NMR experiments (noted below) ...
-
bioRxiv - Cell Biology 2021Quote: ... The mass evaluated using UV as concentration source was 55.7 kDa for the 2 mg/ml sample.The Odinarchaeota samples were analysed by SEC-MALS (100 μl protein complex at 2 mg/ml) were passed over a Superdex 200 10/300 Increase GL column (GE Healthcare), in 20 mM Tris (pH 8.0) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM DTT followed by size exclusion chromatography to remove any protein aggregates using a Superdex 75 column (GE Healthcare) in 25 mM HEPES (pH 7.5) ...
-
bioRxiv - Plant Biology 2020Quote: ... Desalting columns (NAP-5 and PD-10) and N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)proprionamide (HPDP-biotin) were purchased from GE Healthcare and Pierce ...
-
bioRxiv - Cancer Biology 2020Quote: ... purified RNA was electrophoresed in non-denaturing 2% agarose TBE gel and then gel was blotted onto an Hybound-N nylon membrane (RPN303N, GE Healthcare) by semidry electroblotting in 0.5× TBE buffer for 2 hours at 200mA ...
-
bioRxiv - Biophysics 2021Quote: ... 100-μl protein samples (at approximately 2 mg/ml) were loaded onto a Superdex 200 or 75 10/300 GL Increase size-exclusion chromatography column (GE Healthcare) in 20 mM Tris HCl ...
-
bioRxiv - Biophysics 2020Quote: ... followed by 2 CV of 100% IEX buffer B using an ÄKTA Pure fast protein liquid chromatography (FPLC) system (GE Healthcare). To determine the point of elution of aSyn from the chromatography column protein fractions which were collected and monitored on absorption at 280 nm were ran on a 4-12% Bis-Tris gel (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... Peak fractions were pooled, diluted ~5 fold with buffer 0 (20 mM HEPES, 2 mM DTT) and loaded onto a Q column (GE Healthcare). Rad33 was then eluted from the Q column using a linear gradient of Q buffer A (20 mM HEPES ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Biophysics 2022Quote: Binding kinetics of ACE2 and SARS-CoV-2 RBDs were determined by surface plasmon resonance using a Biacore S200 (GE Healthcare). All experiments were performed in a running buffer composed of 10 mM HEPES ...