Labshake search
Citations for GE Life Sciences :
7151 - 7200 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Radiotracer [18F]FDG was produced using FASTlab synthesis platform (GE Healthcare) as previously described (Hamacher et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 mM UltraGlutamine (GE Healthcare, UK), BME vitamins (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Cell Biology 2022Quote: ... incubated in HRP conjugated secondary antibodies detailed in Table 4 for 1 h at room temperature and developed using Pierce SuperSignal Pico Plus (Pierce) or ECL (GE Healthcare) reagent and imaged on ImageQuant.
-
bioRxiv - Cell Biology 2022Quote: ... The multiple cell images were subsequently segmented and high content analyzed using IN Cell Developer software (GE Healthcare).
-
bioRxiv - Cell Biology 2022Quote: ... and 5% CO2 the plate was transferred to the IN Cell Analyzer 2200 (GE Healthcare) for image acquisition under cell culture environmental conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... The final step included size exclusion chromatography (SEC) on a Superdex 75 column (GE Healthcare) in buffer D ...
-
bioRxiv - Cell Biology 2022Quote: ... The most concentrated fraction was directly applied to size exclusion chromatography (SEC) Superdex 200 column (GE Healthcare) in buffer D (25 mM HEPES pH 7.5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell supernatants/lysates were precleared using 30 μl of a 50% slurry of Protein G Sepharose (GE Healthcare, #17-0618-01), while for IP of pyo-KSR1 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.1 mg protein were loaded on a Superdex 200 10/300 GL size-exclusion column (GE Healthcare) connected to an ÄKTA pure (GE Healthcare ...
-
bioRxiv - Cell Biology 2022Quote: ... 3D-SIM was performed on an OMX V3 Blaze microscope (GE Healthcare) using 405- ...
-
bioRxiv - Cell Biology 2022Quote: ... Images were acquired using softWoRx v4.1.2 software (Applied Precision). Images were acquired every 5 minutes during 9 to 15 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... ECL Prime (GE Healthcare, RPN2232); Mnemiopsis leidyi protein models (Mnemiopsis Genome Project Portal ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by gel filtration chromatography on a Superdex 75 16/60 column (GE Healthcare), in 50 mM Tris pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by gel filtration chromatography on a Superdex 200 16/60 column (GE Healthcare), in 50 mM Tris pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... was loaded onto the Superdex 75 16/60 column (GE Healthcare) for gel filtration ...
-
bioRxiv - Cell Biology 2022Quote: ... The 6x His tag was removed by TEV protease digestion followed by passage over NiNTA followed by a final gel filtration chromatography on a Superdex 200 16/60 column (GE Healthcare). The final purified protein was concentrated to approximately 10 μM and snap frozen on liquid nitrogen in small aliquots.
-
bioRxiv - Cell Biology 2022Quote: ... the 6x His-MBP fusion was further purified on a Superdex 200 16/60 column (GE Healthcare), in 50 mM Tris pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by gel filtration chromatography on a Superdex 200 16/60 column (GE Healthcare), in 50 mM Tris pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... the eluate was loaded on an equilibrated Superdex 75 16/60 column (GE Healthcare), and the protein purity assessed using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Cell Biology 2022Quote: For ratio imaging to assess differences in ROS content between esi-CTRL and esi-PDHB treatments in Hyper 7 expressing cells a Delta Vision Core wide-field deconvolution fluorescence microscope equipped with a CoolSNAP HQ2/HQ2-ICX285 camera (Applied Precision Inc.) and a UPlanSApo 40X/NA 0.95 lens (Olympus ...
-
bioRxiv - Cancer Biology 2022Quote: ... and transferred to Hybond P 0.45 PVDF membranes (GE Healthcare, Chicago, IL, USA). Membranes were blocked with 5% BSA (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were separated by a 10% SDS-PAGE and transferred to a nitrocellulose membrane (Amersham Protran 0.45 μm NC; GE Healthcare Life Science). The membranes were blocked in 1x TBS-0.1% Tween-20 (TBS-T ...
-
bioRxiv - Cell Biology 2022Quote: ... After incubation with primary antibodies overnight at 4°C followed by the addition of Protein A or G Sepharose beads (GE Healthcare) for 2-3 hrs ...
-
bioRxiv - Cell Biology 2022Quote: ... Immunoprecipitated complexes were pull-down using Protein A Sepharose beads (GE Healthcare) were at 40C for 2 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... were captured on a Streptavidin (SA) Series S Sensor Chip (GE Healthcare). Chip capture was performed in HBS-P+ buffer (GE Healthcare ...
-
bioRxiv - Cell Biology 2022Quote: ... FPLC-purified biotinylated proteins (ligands) in HBS-P+ Buffer (GE Healthcare) were captured on a Streptavidin (SA ...
-
bioRxiv - Cell Biology 2022Quote: ... Chip capture was performed in HBS-P+ buffer (GE Healthcare) to aim for ∼100-200 ligand response units (RU) ...
-
bioRxiv - Cell Biology 2022Quote: SPR experiments were performed using a Biacore T100 instrument (GE Healthcare). FPLC-purified biotinylated proteins (ligands ...
-
bioRxiv - Cell Biology 2022Quote: ... on an ÄKTA Pure FPLC (GE Healthcare), FPLC traces for purified proteins used for the CRISPRa enrichment screens and SPR validation can befound in Figure S8 and S9.
-
bioRxiv - Cell Biology 2022Quote: ... Flow cell 1 was left empty to use this flow cell as a reference flow-cell for on-line subtraction of bulk solution refractive index and for evaluation of non-specific binding of analyte to the chip surface using Biacore T100 Control Software (version 3.2) (GE Healthcare). FPLC-purified non-biotinylated protein was used as analyte ...
-
bioRxiv - Cell Biology 2022Quote: ... The lysate was cleared from debris by centrifugation and the supernatant was incubated with 20 µl StrepTactin beads (GE Healthcare) for 45 min ...
-
bioRxiv - Biochemistry 2022Quote: ... spectrochromatography was used during the final preparative SEC run on a Superdex 75 column (GE Healthcare). Column size is specified in figure legends ...
-
bioRxiv - Biochemistry 2022Quote: ... The complex was further purified by size exclusion chromatography (SEC) on a HiLoad 16/600 Superdex 200 column (GE Healthcare) equilibrated in SEC Buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples (50 μl) were loaded on a Superdex 200 Increase column (GE Healthcare, Chicago, Illinois, USA) pre-equilibrated with a 20 mM Tris-HCl buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... of GlOCPX or SynOCP1 samples (5 mg/ml in 50 μl) was performed on a Superdex 200 Increase 10/300 column (GE Healthcare) connected to a Prostar 335 detector (Varian ...
-
bioRxiv - Biochemistry 2022Quote: ... and further purified by size exclusion chromatography using a Superdex 75 (16/600) column (GE Healthcare) in 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... The flow-through fraction was concentrated and further purified by size exclusion chromatography using a Superdex 200 (16/600) column (GE Healthcare) in 20 mM Tris-HCl pH 7.8 ...
-
bioRxiv - Biochemistry 2022Quote: ... Dialyzed proteins were loaded onto two 5 mL HiTrap Heparin HP columns (GE Healthcare) connected in tandem ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 % glycerol into two 5 mL MBP-trap cartridges (GE Healthcare) connected in tandem before removal of the Ni-NTA cartridges ...
-
bioRxiv - Biochemistry 2022Quote: ... Dialyzed proteins were loaded onto a 5 mL HiTrap Heparin HP column (GE Healthcare) and eluted with a linear gradient of 20 mM HEPES-KOH pH 7.5 ...
-
bioRxiv - Biophysics 2022Quote: ... pH 7.4) and applied to a 5 mL MBPTrap HP column (GE Healthcare) preequilibrated with binding buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared supernatants were then incubated with 500 μl glutathione sepharose 4B beads (GE Life Sciences, 17-0756-01) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were applied to PD-10 columns (GE Healthcare) to remove residual Zn2+ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Typhoon FLA-7000 (GE Healthcare), or a cooled CCD camera system ...
-
bioRxiv - Molecular Biology 2022Quote: ... Gel Filtration Column: HiLoad 16/60 Superdex 200 (GE Healthcare). Selected fractions were examined on SDS-PAGE gels before pooling ...
-
bioRxiv - Molecular Biology 2022Quote: ... The purified S2~UBC9 was concentrated and subjected to size-exclusion chromatography (SEC) with a Superdex 75 10/300 GL column (GE Life Sciences) on an ÄKTA explorer fast protein liquid chromatography (FPLC ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Image Scanner III image scanning system (28-9076-07 GE Healthcare, USA) was used for gel imaging ...
-
bioRxiv - Molecular Biology 2022Quote: ... and transferred to a Hybond-P PVDF membrane (GE Healthcare) using a semi-dry apparatus (Bio-rad Trans-Blot Turbo) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Detection of peroxidase activity was performed by using the Amersham ECL western blot detection kit (GE Healthcare).