Labshake search
Citations for Millipore Sigma :
4901 - 4950 of 5488 citations for IL 8 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Cells were further washed after 3 days and the medium changed to RPMI supplemented with 10% heat-inactivated human serum (Sigma). MDM were then infected 3-4 days later at low multiplicity of infection ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were washed two times and horseradish peroxidase (HRP)-conjugated goat anti-human IgG antibody (Sigma Aldrich, St. Louis, MO) was used at a 1:5,000 dilution and incubated at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: All laboratory-adapted strains were maintained in human foreskin fibroblasts (HFF) cells in high glucose DMEM with sodium bicarbonate (Sigma) supplemented with 5% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 5% heat-inactivated AB human serum, antibiotics (penicillin, 200 U/ml; and streptomycin, 0.1 mg/mL) and L-glutamine (1 mM) (Sigma-Aldrich) at a concentration of 1 x 107 cells/mL ...
-
bioRxiv - Immunology 2021Quote: ... that utilizes the same human antibodies.12 Antibodies were prepared 1:500 in carbonate-bicarbonate coating buffer (SRE0034, Sigma-Aldrich), added to each well of a Costar 96-well Assay plate (3369 ...
-
bioRxiv - Cell Biology 2020Quote: Bacterial expression vectors for human Arf1 (UniProtKB: P84077) and Arf6 (UniProtKB: P62330) were constructed using a pET-41 Ek/LIC vector kit (Novagen), as described for protein expression of human Rab-family small GTPases (Tamura and Mima ...
-
bioRxiv - Microbiology 2019Quote: ... the slides were incubated for 2 hours at room temperature with 1 µg/mL Cy3-conjugated goat anti-human IgG (H+L) (Sigma) and washed again ...
-
bioRxiv - Microbiology 2020Quote: Freshly isolated purified human neutrophils were seeded on 12 mm Poly-D-lysine-coated (0.01 % solution overnight; Sigma-Aldrich; P7405) coverslips at a concentration of 1 × 106 cells/ml (5 × 105 cells/mL per well ...
-
bioRxiv - Cell Biology 2021Quote: MEFs expressing mEmerald-β-actin were plated on the coverslips coated with 10 μg/mL human plasma fibronectin (EMD Millipore). The coverslips with cells were mounted on the microscope slides for imaging ...
-
bioRxiv - Cell Biology 2021Quote: ... Zygotes were obtained by dissecting the ampulla of the oviduct 24 hours post-injection of human chorionic gonadotropin (hCG) and treated briefly with 1mg/ml of hyaluronidase (Sigma) in M2 medium (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... GMPS were sorted as described above from CD45.1 and cells were cultured in a 12 well plate pre-coated with human fibronectin (EMD Millipore) in RPMI1640 media + 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Biophysics 2021Quote: ... the cDNA sequence coding for the intracellular portion of human EphA2 (residues S570-D976) was cloned into the pET29a(+) vector (Novagen) to express EphA2 protein with a C-terminal 6xHis-tag ...
-
bioRxiv - Microbiology 2022Quote: ... These wells were washed five times using 1× PBST and followed by addition 50 μl/well of anti-human IgG horseradish peroxidase (HRP) (Sigma) diluted in Stabilzyme Noble (Surmodics) ...
-
bioRxiv - Neuroscience 2022Quote: The MILLIPLEX® MAP human amyloid beta and tau magnetic bead panel 4-plex ELISA kit (Millipore, Burlington, MA, USA) and the Bio-Plex 200 System instrument (Biorad ...
-
bioRxiv - Genomics 2022Quote: Multiplexed cytokine quantification was profiled using the 38-plex Human Cytokine/Chemokine Magnetic Bead Panel on the Luminex MAGPIX instrument (Millipore). IL8 was measured with Human IL8/CXCL8 DuoSet ELISA (R&D Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: A mix of diploid and tetraploid cells (see Induction of tetraploidy in human cell lines section) were incubated with 2µg/ml Hoescht 33342 (94403 from Sigma Aldrich) for 1hr at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... The sample was then washed twice with 2X SSC and digested by 3 incubations (10 minutes for mouse and 5 min for human) with digestion buffer containing 1% (w/v) sodium-dodecyl-sulfate (SDS, Sigma), 20 mM Tris HCl (Thermo) ...
-
bioRxiv - Bioengineering 2022Quote: ... All primary cells were used between subculture 3–7 and were routinely cryopreserved in 90% human serum (#H4522; Sigma-Aldrich) supplemented with 10% dimethyl sulfoxide (DMSO).
-
bioRxiv - Immunology 2022Quote: A similar protocol was performed for human NK cells with the exceptions that RPMI plus 10 % FBS and penicillin and streptomycin (Sigma) and 5 ng/ml recombinant human IL-15 (Preprotech ...
-
bioRxiv - Cancer Biology 2022Quote: ... we used Herceptin® at 5 µg/ml and goat anti-human Alexa Fluor® 647 (Sigma, St. Louis, MO) at 1:750 dilution ...
-
bioRxiv - Immunology 2022Quote: ... and Goat Anti-Human IgM Fc5μ Fragment specific HRP conjugated secondary antibody for IgM (Cat# AP114P, EMD Millipore, Burlington, MA). After the incubation ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA knockdown vectors for mouse Mdm2 (TRNC0000302276) or human MDM2 (TRCN0000355726, TRCN0000355727, TRCN0000355728, TRCN0000003378 and TRCN0000003380) were from Sigma Aldrich. The pBabe-puro expression vector for CA-AMPK has been described53.
-
bioRxiv - Microbiology 2021Quote: ... Cytokine quantification was performed using a Human Cytokine/Chemokine/Growth Factor Panel A 48-Plex Premixed Magnetic Bead Multiplex Assay (Merck Millipore), using the Luminex MAGPIX System in 96-well plate format ...
-
bioRxiv - Microbiology 2021Quote: ... Non-adherent cells were washed and the remaining monocytes were maintained in DMEM high glucose with 5% human serum (HS; Millipore) and P/S ...
-
bioRxiv - Molecular Biology 2020Quote: ... mt1 and mt2 were generated by inserting the ORF of human TruB1 and its mutants into the pET22b vector (Merck Millipore) at the NdeI and XhoI sites ...
-
bioRxiv - Neuroscience 2021Quote: ... pSIH-mCherry-KDEL construct expressing lentiviruses were added to the suspension of motoneurons before plating on polyornithine-(PORN) and human merosin-coated (CC085, Merck-Millipore) plates ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was washed with PBS-Tween 20 0.05% and incubated with peroxidase-conjugated anti-human IgG antibody (Sigma, USA) at a dilution of 1 ...
-
bioRxiv - Cell Biology 2021Quote: Washed platelets (160 μL with 0.5×106 platelets/μL) were analyzed in the presence (collagen) or absence (thrombin) of 70 μg/mL human fibrinogen (Sigma). Light transmission was recorded on a four-channel aggregometer (Fibrintimer ...
-
bioRxiv - Biochemistry 2021Quote: ... Removal of the GST-tag from human and zebrafish Vps29 was performed using on-column cleavage with thrombin (Sigma-Aldrich) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... SUM149PT were grown in SUM medium (1:1 mix of DMEM/F12 and Human Mammary Epithelial Cell Growth Medium (Sigma), 5% FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... followed 48 hours later by intraperitoneal injection of 5 IU human chorionic gonadotropin (PMS from SIGMA, HGC from Millipore USA). Mouse zygotes were obtained by breeding B6/CBA stud males with superovulated B6/CBA females at a 1:1 ratio ...
-
bioRxiv - Neuroscience 2021Quote: ... followed 48 hours later by intraperitoneal injection of 5 IU human chorionic gonadotropin (PMS from SIGMA, HGC from Millipore USA). Mouse zygotes were obtained by breeding B6/CBA stud males with superovulated B6/CBA females at a 1:1 ratio ...
-
bioRxiv - Neuroscience 2022Quote: ... This cell line allows the induction of Ngn2 expression and the puromycin resistance gene by the addition of Doxycycline for differentiation into neurons.30 Human iPSCs were maintained in feeder-free culture using Matrigel (Sigma) coated plastic dishes and StemFlex medium (StemCell ...
-
bioRxiv - Microbiology 2022Quote: ... gonococci were incubated (5 min and in parallel with the infections outlined above) in SH- and antibiotic-free cell culture medium spiked with normal human complement (Sigma) to a final concentration of 6% ...
-
Inhibition of major histocompatibility complex-I antigen presentation by sarbecovirus ORF7a proteinsbioRxiv - Microbiology 2022Quote: ... and human alveolar basal epithelial A549 cell line were maintained in DMEM supplemented with 10% fetal bovine serum (Sigma F8067) and gentamicin (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Two pLKO.1 lentiviral vectors encoding for specific shRNA for two human MAPK7 mRNA sequences were used (TRCN0000010262/pLKO.1 and TRCN0000010275/pLKO.1, Sigma). Lentiviral particles were generated in HEK-293 cells by co-transfecting the virion vectors (psPAX2 and pMD2G ...
-
Structure and Neutralization Mechanism of a Human Antibody Targeting a Complex Epitope on Zika VirusbioRxiv - Microbiology 2022Quote: ... Plates were washed with TBS containing 0.2% Tween and incubated for 1 hour at 37°C with Goat anti-human Fc (Sigma, A9544) or Fab (Jackson immunoResearch AB_2337617 ...
-
bioRxiv - Cell Biology 2019Quote: Undifferentiated SGBS cells were plated at 50 % confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were trypsinized and seeded on top of glass coverslips coated with 10 μg/ml of human fibrinogen (Sigma-Aldrich). Cells were fixed two hours later with 2% formaldehyde (Tousimis ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected with human ASCL1 stealth siRNA (129901-HSS100744, Thermo-Fisher) using X-tremeGENE siRNA Transfection Reagent (4476115001, Sigma) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Concentrations of 29 cytokines/chemokines were measured in 2-4 biological replicates using MILLIPLEX Map Human Cytokine/Chemokine Magnetic Bead Panel (HCYTMAG-60K-PX29, #Millipore) according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... Samples were then diluted 1:2 in serum matrix for analysis with Milliplex Non-Human Primate Magnetic Bead Panel as per manufacturer’s instructions (Millipore Corporation). Concentrations for each cytokine were determined for all samples using the Bio-Plex 200 system (BioRad Laboratories Inc.).
-
bioRxiv - Microbiology 2021Quote: ... ScAb or mAb samples were incubated with the antigen in doubling dilutions and the binding was detected using anti-Human C Kappa horseradish peroxidase (HRP) conjugated secondary antibody (Sigma) (for scAbs ...
-
bioRxiv - Pathology 2021Quote: ... postmortem kidney was fixed in 20% formalin for 2 weeks and processed for free-?oating preparation as done for mouse tissue with one exception that anti-human CD31 antibody (CBL468, 1:20 dilution, Millipore) was used.
-
bioRxiv - Pathology 2021Quote: ... Cytokine profiling analysis was performed by Eve Technologies (Calgary, AB Canada) using the Milliplex MAP Human Cytokine/Chemokine Panel (Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Immunology 2021Quote: Primary human monocytes were isolated from buffy coats from healthy blood donors by density gradient centrifugation (Histopaque™, Sigma-Aldrich). For studies of monocytes and M1/M2-type macrophages ...
-
bioRxiv - Pathology 2019Quote: Seven-µm-thick sections of human or murine atrial samples were stained with PicroSirius red according to manufacturer’s instructions (Sigma-aldrich). Bright images were acquired with a Nikon DS-Ri1 camera coupled to Eclipse-Ti Nikon microscope and Nis-Element software (Nikon France S.A. ...
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Biochemistry 2019Quote: ... STAT1 (0.3 µM) (Biosource, PHF0011) was phosphorylated in vitro by incubation with recombinant human cdk1/cyclinB (0.2 µM) (Millipore, 14-450) at 30 °C for 90 min in the presence of 1 mM ATP ...