Labshake search
Citations for Millipore Sigma :
4101 - 4150 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The fixed thin gel cultures were permeabilized in PBST (0.2% (vol/vol) TritonX-100 in PBS) at room temperature for 1h and blocked with blocking buffer (5% (wt/vol) BSA (Sigma, cat. # A2153), 2% (wt/vol ...
-
bioRxiv - Developmental Biology 2023Quote: ... the sections were blocked for 1 hour with blocking solution and then incubated with the indicated primary antibody pairs as multiplex with N1/DLL4 (Sigma, Duolink DUO92008), N1ex/JAG1ex (sigma Duolink DUO92013) ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were blocked in 5% non-fat milk/TBST for one hour at room temperature and incubated overnight at 4°C with the following primary antibodies diluted in blocking reagent: 1 μg/mL mouse α-alpha-tubulin (DM1A, EMD Millipore), 1 μg/mL rabbit α-LEM-2 (Novus Biologicals) ...
-
bioRxiv - Cell Biology 2023Quote: ... Hepatocytes were permeabilized for 1 h at room temperature in blocking buffer consisting of 2% Bovine Serum Albumin (Millipore Sigma cat A2153) and 0.2% Triton X-100 (Millipore Sigma cat 648466 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies were then added and samples incubated overnight at 4°C in blocking solution at the following dilutions: mouse α-FLAG (1:1000, M2 clone, Sigma #F3165), mouse α-V5 (SV5-Pk1 ...
-
bioRxiv - Neuroscience 2023Quote: ... for 1 hr at RT and blotted overnight at 4°C in the same blocking solution with the following antibodies: Rabbit Anti-GluK1 (1:1000; Millipore: 07-258), Rabbit Anti-GluK2/3 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... Membranes were incubated with 5% BSA in 0.1% TBS-Tween for 1 hr at room temperature for blocking step and incubated with 1:1000 anti-RFC1 antibody produced in rabbit (Sigma-Aldrich; AV44167) at +4°C overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... T8787)/PBS at 37C for 2 days and subsequently immersed in a blocking solution of 10% DMSO + 6% donkey serum (EMD Millipore: S30) + 0.2% Triton X-100/PBS at 37C for 3 days ...
-
bioRxiv - Neuroscience 2023Quote: ... For IHC we permeabilized and blocked sections with blocking solution (PBS containing 5% normal goat serum [Thermo Fisher Scientific # 10000C] and 0.1% Triton X-100 [Millipore-Sigma # X100-100ML]) for 60 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... then in the anti-dopamine receptor antibody diluted in the blocking solution for 5-6 days at 4°C (rabbit anti-dopamine D1A receptor, 1:100, Sigma-Aldrich AB1765P). Sections were washed in PBS and incubated for 2 h at RT in the secondary antibody (goat anti-rabbit Alexa Fluor 555) ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated overnight at 4°C with the corresponding primary antibodies diluted in blocking buffer: mouse anti-β-Actin 1:2000 (Sigma, #A544); mouse anti-3R-Tau 1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were incubated overnight at 4°C in blocking solution with the addition of the following antibodies (dependent on experiment): goat anti-ChAT (Millipore Sigma AB144P), rabbit anti-cFos (Synaptic System 226 008) ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were permeabilised overnight at 4°C and then transferred to blocking solution (10% DMSO, 6% normal donkey serum (NDS; Sigma-Aldrich, D9663), 0.2% Triton X-100 in DPBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Fixed coverslips were transferred into 12-well plates and outlined with a hydrophobic pen and blocked using 40 μL of Duolink blocking buffer (Sigma Aldrich, DUO82007) at 37 °C for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then incubated with PBG blocking buffer (0.2% w/v, cold water fish gelatin-Sigma G-7765; 0.5% w/v, BSA-Sigma A-2153 in PBS) for 30 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was incubated in blocking buffer (5% non-fat dry milk (Carlroth, Cat no. T145.1) in TBST containing 0.005% Tween-20 (Sigma, Cat no. P7949-500ML), or 0.02% Tween-20 (TBST-XL)) ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were incubated in antibodies for 48h at 4 °C in a blocking solution and immunolabeled with chicken anti-Nefh (1:5000, EMD Millipore, AB5539), mouse anti-Syn1 (1:1000 ...
-
bioRxiv - Bioengineering 2024Quote: ... Slides were then incubated in a humidity chamber at room temperature for 1 hour with blocking solution covering the tissue (5% normal donkey serum (Sigma Cat#D9663) in PBS with 0.1% Tween 20) ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 µM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone; SIGMA, USA) at a 23.7×108 cfu/ml (OD600=0.75 ...
-
bioRxiv - Neuroscience 2021Quote: ... for 3 h followed by ATP (2 mM, Sigma Aldrich, A6419-5g ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit polyclonal anti-PCSK1 (PC1/3) (1:1000, Sigma, #SAB1100415), rabbit polyclonal anti-TSSC1/EIPR1 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 200 μM 3-isobutyl-1-methylxanthine (IBMX; Sigma), and their cumulus cells were removed by gentle pipetting ...
-
bioRxiv - Cell Biology 2020Quote: ... 250 μM 3-isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich # I5879), 1 μM rosiglitazone (Cayman Chemical # 71742) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were blocked and simultaneously permeabilized with 3% BSA (SIGMA) and 0.2% Triton X-100 (SIGMA ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were subsequently blocked and permeabilized with 3% BSA (SIGMA) and 0.2 w/v % Saponin (Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... or 3 µg/cm2 poly-L-lysine (Sigma-Aldrich, P6407) overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x Phosphatase inhibitor cocktail 2 and 3 from Sigma-Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... and then blocked with 3% (w/v) BSA (Sigma-Aldrich) and 0.05% (v/v ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3-15 µM MG132 (Z-Leu-Leu-Leu-al, Sigma) was added to the media for the indicated hours prior to cell lysis/fixation ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-Caspase-3 antibody (Sigma USA, Dubey and Tapadia, 2017) was used at a dilution of 1:100 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 30 μL D2O with 3%TPS (Sigma Aldrich, 450510) and transferred in a standard 5 mm NMR tube (Wilmad-LabGlass ...
-
bioRxiv - Neuroscience 2022Quote: ... propyl acetate and 3-methyl-2-buten-1-ol (Sigma). Odorants were selected based on previous work using this task (Gu & Li ...
-
bioRxiv - Biophysics 2022Quote: ... 250 μM 3-isobutyl-1-me-thylxantine IBMX (Sigma-Aldrich), 100nM cortisol (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 1X Phosphatase inhibitor cocktails 2 and 3 (Sigma P5726, P0044), and 1X Protease inhibitor tablets (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and dispase-II (3 mg/mL, Cat# D4693, Sigma-Aldrich) for 60 min at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-Partitioning-defective 3 (Par3) (Sigma, 07-330, 1:1000), anti-Parvin (Cell signaling ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were incubated for 3 days in JB-4 (Sigma)/Eosin (Sigma)/Acridine orange (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... DL-Serine Hydroxymate (SHX, Sigma CAS Number 55779-32-3), an inhibitor of seryl-tRNA synthetase which triggers the stringent response and prevents new rounds of replication ...
-
bioRxiv - Bioengineering 2022Quote: ... 121 mg of N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide ( EDC) (Sigma) and 28 mg of RGD peptide ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3:1 mixture of random hexamers/OligodT (Sigma-Aldrich), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μL of 1 mg/mL RNase A (Sigma R6148) and 3 μL of 20 mg/mL Proteinase K (NEB EO0491 ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 3% murine plasma and 10 mM HEPES (Sigma) and left to settle for 45 minutes in the incubator at 37°C and 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Phostphatase Inhibitor Cocktail 3 (Sigma-Aldrich; St. Louis, MO, USA) 1x TBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Phostphatase Inhibitor Cocktail 3 (Sigma-Aldrich; St. Louis, MO, USA) 1x TBS ...
-
bioRxiv - Biophysics 2019Quote: ... then bound proteins were eluted with 3 mM desthiobiotin (Sigma) or 50 mM D-biotin (CHEM-IMPEX ...
-
bioRxiv - Neuroscience 2019Quote: ... the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich, Ref. #TRCN0000012392) or the shRNA control (dsRed2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and Phosphatase Inhibitor Cocktail no.2 and no.3 (Sigma). Following manufactures recommendations ...
-
bioRxiv - Physiology 2019Quote: ... and 100 μM 3-isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich) was added to elicit a maximal cAMP response ...