Labshake search
Citations for Millipore Sigma :
3951 - 4000 of 5488 citations for IL 8 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Ear biopsies of mice 4–8 weeks old were incubated at 55°C for overnight in lysis buffer containing 75 mM NaCl (SIGMA, S9888), 25 mM EDTA (Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... Stock cultures were stored at -80°C in cryogenic vials by resuspension of fresh growth in Tryptic Soya Broth (TSB; Oxoid) containing 8% (v/v) dimethyl sulfoxide (Sigma Aldrich). Culture purity was determined by plating frozen stocks onto Tryptic Soy Agar (TSA ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μL lysate was mixed with 45 μL MUG (methylumbelliferyl b-D-glucuronide) solution (10 mM Tris/HCl pH 8, 2 mM MgCl2, 1 mM MUG (Sigma Aldrich)) in a 96-well plate ...
-
bioRxiv - Genomics 2022Quote: ... K562 or Jurkat cell lines expressing CRISPRi effectors of interest were infected with lentivirus containing sgRNA expression vectors by centrifugation at 1000 × g for 1 h in 24-well plates in the presence of 8 µg/mL polybrene (Sigma-Aldrich). RPE1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lysates were sonicated on ice with a microtip sonicator (120 W, 8 s on, 2 s off, 3 pulses) and supplemented with 200 U of benzonase (Sigma; E8263). The lysates were cleared by centrifugation (18000 g ...
-
bioRxiv - Molecular Biology 2022Quote: ... were grown in TYG medium (with/without kanamycin; 8 µg/ml) in 96 well microtiter plates after washing with PBS (Nunclon; Sigma-Aldrich). Optical density at 600nm was measured to examine the growth in replicates at 32 °C for 18 h using Synergy H1 Hybrid multi-mode microplate reader ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a constant flow rate of 0.8 ml/min and a constant temperature of 22°C with mobile phase A being 0.4 % acetic acid (Sigma-Aldrich, USA) in water and phase B being 20% Methanol (Honeywell ...
-
bioRxiv - Cancer Biology 2022Quote: LLC cells were treated with conditioned media from inflammasome-induced macrophages as indicated and 5 × 104 cells per well were seeded in top chambers of the transwell chamber (8 μM pore, 24-well plate, Millipore-Sigma) in FBS-free media with membrane inserts ...
-
bioRxiv - Cell Biology 2022Quote: ... filtered through 0.22 μm filter and used to infect HUVECs (passage 2) in the presence of polybrene (8 μg/ml, H9268; Sigma-Aldrich). The transduced HUVECs were selected with puromycin (8ug/ml ...
-
bioRxiv - Developmental Biology 2024Quote: ... the lysates were separated on 8% v/v or 12% v/v polyacrylamide gels and transferred to a Polyvinylidene difluoride (PVDF) membrane (Millipore ISEQ00010). Membranes were incubated in 5% w/v milk buffer for 1 h at room temperature and incubated in primary antibody overnight at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... BEAS-2B cells grown in 6-wells plates were first transduced with lentiviruses encoding Cas9 diluted in infection medium (DMEM, 2% FCS) containing 8 μg/ml Polybrene (Sigma Aldrich). At 16 h post transduction ...
-
bioRxiv - Cancer Biology 2024Quote: ... Immunoprecipitation was performed using 8 µg of fragmented DNA incubated for 14h at 16°C with 20 µg of S9.6 antibody (Millipore, cat. MABE1095). Next the complexes were captured on ProteinA/G agarose beads (ThermoFisher Scientific R0561) ...
-
bioRxiv - Physiology 2024Quote: ... quail were placed in glass chambers (3.3 L at 3 weeks; 8.0 L at 8 weeks) ventilated with dried (via drierite; Sigma-Aldrich, Stockholm, Sweden) atmospheric air at least 30 minutes before measurement ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 1ml of blood was split into two flasks with 30ml of media added to each and delayed until 8 pm on Wednesday at which point dimethyl sulfoxide (DMSO) was added to one flask and rapamycin (Sigma-Aldrich) resuspended in DMSO added to the other at a 1:10,000-fold dilution to give a final rapamycin concentration of 10nM ...
-
bioRxiv - Microbiology 2023Quote: ... cells were infected at an estimated MOI of about 1 for each lentivirus in the presence of 8 µg/ml polybrene (EMD Millipore) in 1.5 ml inoculum and incubated at 37 °C for 2 h rocking and rotating every 10 min before adding 8.5 ml of 5 % FBS/DMEM ...
-
bioRxiv - Neuroscience 2024Quote: ... Demyelination was induced in 8-week-old male mice via a 0.2% w/w cuprizone diet (Sigma-Aldrich, cat# C9012-25G). The diet was freshly prepared by mixing cuprizone with standard powder food and water ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were washed with A-RPMI and cultured from day 4 to day 8 in A-RPMI supplemented with 1 μM retinoic acid (Sigma R2625) and 100 ng/ml FGF2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Equal quantities of proteins (20 μg/lane) were loaded onto 8% or 10% SDS-PAGE gels and subsequently transferred to PVDF membranes (Millipore, USA). The membranes were then incubated with primary antibodies overnight at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... coated 15μ-Slide 8 well (ibid) and incubated for 2h at 37LJ in RPMI 1640 supplemented with 10% BSA (Sigma-Aldrich). Cells were fixed using 1% [w/v] paraformaldehyde (PFA ...
-
bioRxiv - Cell Biology 2024Quote: ... 3T3-L1 fibroblasts were transduced with titrated viruses in presence of 8 µg/mL of polybrene (Hexadimethrine bromide, Cat. No: 107689-10G, Sigma-ALDRICH) and subjected to antibiotic selection using 4 µg/mL puromycin after 48 hours ...
-
bioRxiv - Pathology 2024Quote: Nuclei from frozen mouse kidney outer cortex tissue samples and glomeruli-enriched samples were prepared at 4°C.40 Tissue fragments (∼ 8 mm3) were cut by razor blades in EZlysis buffer (#NUC101-1KT, Sigma-Aldrich) and homogenized 30 times using a loose Dounce homogenizer and 5 times by tight pestle ...
-
bioRxiv - Developmental Biology 2024Quote: ... hPSC were seeded and aggregated in EB formation medium (Essential 8 containing 400 µg/mL Poly (vinil alcohol) (Sigma Aldrich, P8136) and 10 µM Y-27632 (Bio-Connect ...
-
bioRxiv - Cancer Biology 2024Quote: ... The uncured SU-8 was washed away using SU-8 developer and the wafer was silanized using Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma 448931). Sylgard 184 (Ellsworth ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then directly added to the intended cells in the presence of 8-10 µg/ml polybrene (TR-1003-G, Sigma-Aldrich).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Stock solutions of CuSO4 (39 mg/L) were prepared by dissolving CuSO4·5H2O (CAS# 7758-99-8; purchased from Sigma-Aldrich) in distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... was added for 1 hour at room temperature and quenched with 8 µl of 5% (v/v) of hydroxylamine in water (Sigma Aldrich). 1 μl of 200 mM TCEP was added for 1 hour at 55 °C and free thiol groups were alkylated with 1 μl of 380 mM Iodoacetamide (Thermo Fisher ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The buffer of the combined flowthrough was exchanged into assay buffer (20 mM sodium phosphate, 20 mM sodium chloride, pH 8) using a G25 (Sigma-Aldrich) column ...
-
bioRxiv - Developmental Biology 2023Quote: The anterior lobe of freshly dissected 8 to 12 week-old pituitaries was minced and incubated for 15mn at 37°C in 1mg/ml Papain (Sigma 10108014001), 10μg/ml DNAse I (Sigma 10104159001 ...
-
Neural circuit-wide analysis of gene expression during deafening-induced destabilization of birdsongbioRxiv - Neuroscience 2022Quote: ... Anhydrous 100% ethanol solution was prepared by adding 15 g of molecular sieve beads (Sigma 208582, 3 Å, 8-12 mesh) to 500 mL 100% molecular grade ethanol (Sigma E7023) ...
-
bioRxiv - Microbiology 2023Quote: ... α- chymotrysin from bovine pancreas type II (C4129), 8-Anilino-1-naphthalenesulfonic acid (ANS, A1028) and concanamycin A (ConcA, C9705) were purchased from Sigma Aldrich. HBSS ...
-
bioRxiv - Biophysics 2023Quote: ... Dextran from Leuconostoc spp (Mw 450-650 kg/mol), and poly(ethylene glycol) (PEG 8000, Mw 8 kg/mol) were purchased from Sigma-Aldrich. Chloroform obtained from Merck (Darmstadt ...
-
bioRxiv - Microbiology 2023Quote: ... Infection was maintained in 10% FBS DMEM supplemented with 8 µg ml-1 polybrene infection reagent (#TR- 1003-G, Sigma-Aldrich). Twenty-four hours post-infection cells were washed with PBS and the medium was refreshed with complete culture medium ...
-
bioRxiv - Microbiology 2023Quote: ... 5 or 10 μM nocodazole supplemented 10% FBS DMEM medium with 8 µg mL-1 polybrene infection reagent (#TR-1003-G, Sigma-Aldrich). Seven hours after transduction ...
-
bioRxiv - Immunology 2023Quote: ... digested with 0.1% trypsin (Wisent Inc., Canada) for 8 min and then transferred into 0.8 mg/mL Collagenase Type I (Sigma-Aldrich, USA) for 60 min at 37 °C and 5% CO2 with regular vigorous shaking in a humidified incubator ...
-
bioRxiv - Neuroscience 2023Quote: ... Tg37+/- whole hippocampus non-cell specific nascent translatome labelling was accomplished with 4mM AHA (Fluorochem, # 942518-29-8) mixed with 5% Maltose (Sigma, M9171) in drinking water and in a mash diet from 9 w.p.i to 10 w.p.i ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×105 target tumour cells were seeded in 6 well plates and infected with lentiviruses + polybrene (8 µg/mL) before selection of transduced cells using 4ug/mL puromycin (Sigma-Aldrich).
-
bioRxiv - Bioengineering 2023Quote: ... cells were centrifuged at 300 g for 5 minutes and resuspended in Essential 8 Flex medium containing 2 µM ROCK inhibitor Thiazovivin (Millipore Sigma). hPSCs were then counted using a Moxi Cell Counter (Orflo Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... 150 μL cell suspension was mixed with 150 μL DB+ containing 8 mM caffeine (Wako) and 20 μM latrunculin A (Sigma-Aldrich) and placed on a 35-mm glass bottom dish (12-mm glass in diameter ...
-
bioRxiv - Molecular Biology 2023Quote: ... MCF10A cells were infected for 24 h using filtered viral supernatant diluted with culture medium and supplemented with 8 µg/µl protamine sulphate (Sigma-Aldrich). Selection of infected cells with antibiotics was performed 48 h after the infection.
-
bioRxiv - Microbiology 2023Quote: NIH3T3 and BMDC cells were infected with MLV (genome equivalent of a multiplicity of infection [MOI] of 1) in the presence of 8 mg/ml Polybrene (Sigma-Aldrich), and cells were incubated on ice for 1 h to allow virus binding ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transduced with HIV-TOP opt mChΔW lentivirus containing the PIKA library by spinoculation in the presence of 8 µg/mL protamine sulfate (Millipore Sigma #P3369). Two days later (Experiment Day 4) ...
-
bioRxiv - Pathology 2023Quote: ... The cells were infected with lentiviruses carrying the plasmid (MOI = 6) in the presence of Hexamethidine Bromide (8 µg/mL; Sigma-H9268) for 24 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... osm-9 gDNA was amplified with the primers KLB289 (GTTGTTTACCTTTTATGTTCATCCG) and KLB290 (AAATTTTCTACTGCCTGGTATCAAA) off of phenol-extracted followed by ethanol precipitated whole-worm gDNA (Phenol pH 8 from Sigma Aldrich). The osm-9 gDNA fragment plus extra upstream and downstream homologous sequence was amplified off of the gDNA amplified with KLB289 and KLB290 ...
-
bioRxiv - Cell Biology 2023Quote: ... Genetical labelling was induced in epidermis of 6-8 weeks old mice with a single topical administration of 75 μg of (Z)-4-Hydroxytamoxifen (Sigma-Aldrich) (15 mg/mL diluted in acetone).
-
bioRxiv - Bioengineering 2023Quote: ... K562 or Jurkat T cells were seeded into a 24-well plate at 2.5 × 105 cells/well in 1 ml cRPMI and transduced in the presence of protamine sulfate (8 μg/ml, Sigma-Aldrich). Transgene expression was assessed 72 hours post-transduction by flow cytometry ...
-
bioRxiv - Cell Biology 2022Quote: ... the dissociated cells were resuspended in the transduction medium (1 uL to 5 uL of lentivirus, 4 to 8 ug/ml Polybrane[STR-1003-G, Sigma Aldrich] ...
-
bioRxiv - Cell Biology 2023Quote: S2naive and S2Xpress cells were seeded in an 8-chamber Nunc LabTek II that had previously been coated with Poly-L-Lysine (P4832, Sigma-Aldrich). Cells were then incubated for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mL of S2 cell pellets were lysed with 400 μL lysis buffer containing non-ionic detergent (50 mM Tris buffer, pH 8, 150 mM NaCl, 1% IGEPAL CA- 630 (Cat# I8896, Sigma Aldrich), 10% glycerol and 1x protease inhibitor (Cat# A32965 ...
-
bioRxiv - Bioengineering 2023Quote: ... Droplets of the polymer solution were placed between activated dishes and a Sigmacote®-treated 8 mm coverslip (Sigma-Aldrich, US), and allowed to polymerize ...
-
DeCOIL: Optimization of Degenerate Codon Libraries for Machine Learning-Assisted Protein EngineeringbioRxiv - Bioengineering 2023Quote: ... They are next lysed in 300 μL lysis buffer (50 mM potassium phosphate at pH 8, 0).1 mM pyridoxal phosphate (Sigma P9255), 0.1x BugBuster (EMD Millipore Corp ...