Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Microbiology 2022Quote: ... 3 days post-infection 4 mL of paraformaldehyde 4% (#158127, Sigma) was added and incubated overnight at 4ºC ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
Proteasome granular localization is regulated through mitochondrial respiration and kinase signalingbioRxiv - Cell Biology 2022Quote: ... and 2-[2-(3-chlorophenyl)hydrazinylidene]-propanedinitrile (CCCP) (Sigma), were used at final concentrations of 0.5 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-[2-(3-chlorophenyl)hydrazinylyidene]propanedinitrile (CCCP) (Sigma-Aldrich), rhodamine 123 ...
-
bioRxiv - Cell Biology 2021Quote: ... Skin was minced into small pieces (about 2-3 mm × 2-3 mm) and digested by incubation with 1 mg/mL collagenase V (Sigma) in PBS for one hour with shaking (250 rpm) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1:100 Phosphatase Inhibitor Cocktails 2 and 3 (Sigma), 1:1000 Protease Inhibitor Cocktail (Sigma)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1% phosphatase inhibitor cocktails 2 and 3 (Sigma). Extracts were sonicated 3 × 10 s ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1% Phosphatase Inhibitor Cocktail 2 and 3 (Sigma)) and incubated on ice for 15 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 mg.L-1 indole-3-acetic acid (Sigma-Aldrich), 0.5 mg.L-1 2-isopentenyladenine (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... 3) mouse IgG2a anti-GluA2 (Millipore, 1:2 000) and secondary antibodies AlexaFluor 647 donkey anti-rabbit ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910), ATP (Sigma-Aldrich A2383) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2-4 months old mice were orally gavaged with 3 x 2 (Mist1creERT/+KRASG12D/+) or 5 x 5 mg (Ptf1acreERT/+KRASG12D/+) of tamoxifen (TX; Sigma-Aldrich, T5648-5G) at Western University and 5 x 4 mg (Ela-creERT ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Microbiology 2022Quote: ... polymyxin B sulfate and 2-Heptyl-3-hydroxy-4(1H)-quinolone (PQS) (Sigma-Aldrich Corp., St. Louis, MO) were dissolved in water ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mg of 4-OHT (Sigma H7904) were dissolved in 120μl of ethanol ...
-
bioRxiv - Immunology 2022Quote: ... We used 3-4 synthetic sgRNAs (Sigma) per gene ...
-
bioRxiv - Microbiology 2023Quote: ... 4-azidobenzoic acid (6427-66-3, Sigma), propidium iodide powder (25535-16-4 ...
-
bioRxiv - Biophysics 2024Quote: ... 4% (3-Aminopropyl) triethoxysilane (APTES) (Sigma-Aldrich)-treated and 2% glutaraldehyde (Sigma-Aldrich)-activated 35mm glass-bottom dishes (Ibidi ...
-
bioRxiv - Bioengineering 2023Quote: ... Di-tert-butyl decarbonate (BoC2O) and 5-norbornene-2-carboxylic acid were purchased from Sigma Aldrich (St. Louis, MO). Irgacure 2959 was purchased from Advanced Biomatrix (Carlsbad ...
-
bioRxiv - Bioengineering 2021Quote: ... The secondary antibodies were washed away with PBS (3x 5 min) whereafter 4’,6-diamidino-2-phenylindole (DAPI, 1:500, Sigma) was added for 10 minutes to localize the cell nuclei ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclear labelling was achieved by incubating the sections for 5 min in DAPI (4′,6-diamidino-2-phenylindole; 1:5000; Sigma). Two final washes in PBS were performed before the sections were mounted on glass slides using Vectashield (Vector Laboratories ...
-
bioRxiv - Immunology 2024Quote: ... slides were washed in PBS and incubated in 5 μg mL-1 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS (Sigma Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... in 0.1% BSA/PBS supplemented with 5 μg/ml Hoechst or 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI)) or ExtrAvidinCy3 (Sigma) solution (1:100 in 0.1% BSA/PBS supplemented with 5 μg/ml Hoechst) ...
-
bioRxiv - Immunology 2024Quote: ... the allosteric FFA2R modulator Cmp58 ((S)-2-(4-chlorophenyl)-3,3-dimethyl-N-(5-phenylthiazol-2-yl)butanamide) and adenosine 5′-thriphosphate disodium salt hydrate (ATP) were from Sigma-Aldrich (Merck, Burlington, MA, USA). The FFA2R antagonist CATPB ((S)-3-(2-(3-Chlorophenyl)acetamido)-4-(4-(trifluoromethyl ...
-
bioRxiv - Cell Biology 2021Quote: ... Aprotinin (1:5, 4 TIU/ml; Sigma-Aldrich, UK) was added to all blood samples ...
-
bioRxiv - Bioengineering 2022Quote: ... HA-TBA was dissolved in anhydrous DMSO (2 wt%) with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Immunology 2021Quote: ... 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium (BCIP /NBT) liquid substrates for AP-enzyme (SIGMA) were added for overnight incubation at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The unbroken cells were removed by centrifugation (3,000 x g; 4°C; 5 min; Sigma 3-16KL; rotor 11180). The membrane fraction was pelleted down by high-speed centrifugation (100,000 x g ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 250 µL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) (20 mg/ml) (Sigma-Aldrich, UK) and Isopropyl ß-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell disruption was carried out by vortexing (3 cycles, 5 min each) at 4°C using 0.2 ml of glass beads (425-600 μm; Sigma). For the Rpb3 immunopurification ...
-
bioRxiv - Cell Biology 2022Quote: ... was revealed with 5-bromo-4-chloro-3-indolyl β-D galactoside (X-gal) (Sigma-Aldrich, Carlsbad, CA, USA). Diploid cells were grown on SC medium supplemented with 20 mg/L adenine hemisulfate ...
-
bioRxiv - Microbiology 2024Quote: ... Coloring reactions were performed with nitro blue tetrazolium/5-Bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) solution (Sigma), and then sections were washed in PBS ...
-
bioRxiv - Cell Biology 2023Quote: – 5-iodo-2’-deoxyuridine (IdU) and 5-Chloro-2′-deoxyuridine (CldU) (Sigma-Aldrich) were dissolved in sterile DMEM at 2.5mM and 200mM respectively and stored at –20°C ...
-
bioRxiv - Microbiology 2020Quote: ... the medium was replaced with MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (Sigma-Aldrich, St. Louis, MO, USA) final concentration at 0.5 mg/mL and incubated for 4 h at 37°C in a humidified incubator with 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Proliferative capability of BMECs was tested by 3-[4,5-dimethylthiazyol-2-yl] -2,5-diphenyltetrazolium bromide (MTT, 5mg/ml, Sigma, cat# CT01) assay ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mM 3-isobutyl-1-methylxanthine (IBMX) (Sigma, Germany #28822-58-4). After 48 h the induction medium was replaced by the differentiation medium containing DMEM/Ham’s F12 ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4-(Methylnitrosoamino)-1-(3-pyridinyl)-1-butanone (NNK) (78013, Millipore-Sigma) (0.41 mg/dose ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4-(Methylnitrosoamino)-1-(3-pyridinyl)-1-butanone (NNK) (78013, Millipore-Sigma) (0.41 mg/dose ...
-
bioRxiv - Molecular Biology 2024Quote: ... Tubulin (B-5-1-2, Sigma Aldrich, 1:10,000) and subsequently with HRP-tagged secondary antibodies (Jackson Immunoresearch ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 mM 5-Fluro-2’-deoxyuridine (SIGMA U3003). Cells were transfected at DIV17-19 with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5’-fluoro-2’-deoxyuridine (Sigma, 5 μM) were added to the culture medium at days in vitro (DIV ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 5-Fluro-2’-deoxyuridine (SIGMA U3003). Cells were transfected at DIV17-19 with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... and eosin (Sigma HT110-2-3) for two minutes each ...