Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...
-
bioRxiv - Neuroscience 2020Quote: ... 4–5-week-old mice were anesthetized by intraperitoneal injection of 2% 2,2,2-tribromoethanol (Sigma), dissolved in saline ...
-
bioRxiv - Neuroscience 2023Quote: ... (D-Ala(2)-mephe(4)-gly-ol(5))enkephalin (DAMGO, Sigma-Aldrich, Cat. No. E7384) at 50 µM or lipopolysaccharide (LPS ...
-
bioRxiv - Cancer Biology 2021Quote: 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) was purchased from Sigma-Aldrich (L’Isle-d’Abeau-Chesnes, France). Antibodies against phospho-IκBα Ser32 (#2859) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Metabolic activity was measured by adding 10 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; 10 mg/ml, Sigma). After four hours of incubation ...
-
bioRxiv - Microbiology 2022Quote: ... media were aspirated and cells viability was determined by addition of 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) at a final concentration of 0.5 mg/mL ...
-
bioRxiv - Molecular Biology 2022Quote: Cell growth was monitored by cell counting and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay using MTT cell growth assay kit (#CT02, Millipore). FL or ΔN-Drosha cells (1×105 ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 10% FBS and 10% 5mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent (SIGMA) in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... or MG132 using a MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium-based in vitro toxicology kit (TOX1-1KT, Sigma). 10 µl MTT solution was applied to cells at the end point of the experiment and incubated for 4 hours ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The MTT [3-(4,5-Dimethylthiazol-2-Yl)-2,5-Diphenyl-tetrazolium Bromide] dye (M2128) was obtained from Sigma Aldrich. Triple distilled water (Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... Cell viability was determined after 72 hours using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (#M5655, Sigma) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The MTT [3-(4,5-Dimethylthiazol-2-Yl)-2,5-Diphenyl-tetrazolium Bromide] dye (M2128) was obtained from Sigma Aldrich. Triple distilled water (Millipore ...
-
bioRxiv - Cell Biology 2024Quote: ... The number of viable cells was quantified using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; M2128, Sigma) assay at 0 ...
-
bioRxiv - Biochemistry 2024Quote: ... Growth inhibition was assessed with a MMT assay (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (Sigma Aldrich). Optical density was measured at 595 nm and 650 nm with a microplate spectrophotometer (Multiskan ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Bioengineering 2023Quote: Photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy) phenyl]-2-methyl-1-propanone (HEPK, Sigma Aldrich) was dissolved into deionized water to obtain an approximately 0.077 wt% solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2024Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′-TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous references (PPIA ...
-
bioRxiv - Biophysics 2024Quote: ... respectively: EcoEF7,3_For: 5’-GCACTATTTGCTATATATTGTGTGGTTGAATCTTTTTTCAACTACATCTAGTATCTC-3’ and EcoEF7,3_Rev: 5’-GAGATACTAGATGTAGTTGAAAAAAGATTCAACCACACAATATATAGCAAATAGTGC-3’ were ordered from Sigma-Aldrich, resuspended and annealed in buffer containing 10 mM Tris pH 7 ...
-
bioRxiv - Plant Biology 2021Quote: ... 1% phosphatase inhibitor cocktails 2 and 3 (SIGMA), 1% IGEPAL ...
-
bioRxiv - Genetics 2023Quote: ... 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% Phosphatase Inhibitor Cocktail 2 and 3 (Sigma), and 10 mM sodium butyrate) ...
-
bioRxiv - Genetics 2023Quote: ... 1% phosphatase inhibitor cocktail 2 and 3 (Sigma) and 2% protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-4 mg/ml biocytin (Sigma); pH∼7.2 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-4 mg biocytin (Sigma-Aldrich) was included in the intrapipette solution for morphological reconstruction ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were washed 2-3 times with warmed PBS followed by 50 μM 5-chloro-2’-deoxyuridine (CldU, Sigma #C6891) for 20 minutes or 50 μM CldU with 4mM hydroxyurea (HU ...
-
bioRxiv - Synthetic Biology 2022Quote: ... then mixed with 1 mL of the reactive dye 5-([4,6-dichlorotriazin-2-yl]amino)fluorescein hydrochloride (DTAF) (Sigma Aldrich), previously dissolved in DMSO (20 mg/mL) ...
-
bioRxiv - Cell Biology 2023Quote: ... adipocytes were lysed in polysome lysis buffer (20 mM HEPES-KOH pH 7.4, 100 mM KCl, 5 mM MgCl2, 1% Triton X-100, 2 mM DTT, 100 μg ml-1 cycloheximide [Sigma] ...
-
bioRxiv - Cell Biology 2023Quote: ... (phenylmethylsulfonyl fluoride, PMSF 1mM; 1-chloro-3-tosylamido-4-phenyl-2-butanone, TPCK, 10 μg/ml; aprotinin, 10 μg/ml Sigma) incubated for 30min on ice ...
-
bioRxiv - Cell Biology 2024Quote: ... 2-Hydroxy-4’-(2-hydroxyethoxy)-2 methylpropiophenome (Sigma Aldrich) photoactivator was suspended in S Basal (final concentrations of all components ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% (BC-1, BCBL-1) or 20% (BC-2, BC-3, BC-5, BJAB) Serum Plus-II (Sigma-Aldrich, catalog number 14009C ...
-
bioRxiv - Neuroscience 2023Quote: ... GluR2/3: Anti-Glutamate Receptor 2 & 3 antibody (1:500, Millipore, Cat# AB1506). c-Fos ...
-
bioRxiv - Immunology 2022Quote: Fabs (2-4 mg/ml) were mixed with a 2 to 3-fold molar excess of fen-G4 or fentanyl (Sigma F-013) in Dulbecco’s PBS and incubated for 1-2 hours at 4 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3% 2-Hydroxyethyl Agarose (Sigma) was prepared and stored in a water bath at 45 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... 3% 2-mercaptoethanol (Sigma Aldrich), and 0.25 mg/ml Proteinase K (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 and 3 (Sigma-Aldrich). The homogenate was sheared through a 26-gauge needle and sonicated three times for 20-second bursts ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) for 15 min at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... and trans-4-Phenyl-3-buten-2-one (20a) were purchased from Sigma-Aldrich (St. Louis, MO). Ketoisophorone (2a ...
-
bioRxiv - Neuroscience 2024Quote: The GABA-A α5-selective positive allosteric modulator α5IA (3-(5-methylisoxazol-3-yl)-6-[(1-methyl-1,2,3-triazol-4-yl) methyloxy]-1,2,4-triazolo[3,4-a] phthalazine) (Sigma Aldrich Inc ...
-
bioRxiv - Microbiology 2020Quote: ... 200 μL of freshly made 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; 1 mg/mL; Sigma-Aldrich, St. Louis, MO) in serum-free ...
-
bioRxiv - Cell Biology 2022Quote: ... Tubulin [B-5-1-2] (Sigma, 1:5000), Tim23 (BD Transduction Labs ...
-
bioRxiv - Cell Biology 2023Quote: ... Tubulin [B-5-1-2] (Sigma, 1:5000), HSP60 [LK1] (Thermo Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 µM 5-fluoro-2’-deoxyuridine (Sigma), penicillin ...
-
bioRxiv - Cell Biology 2021Quote: ... alpha-tubulin (B-5-1-2, Sigma), tyrosinated tubulin (YL1/2 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μM 5-fluoro-2’-deoxyuridine (Sigma Aldrich 200-072-5), penicillin ...